Содержание

Центр ИСЖ

Государственное учреждение “Центр информационных систем в животноводстве”

Директор Борщ Анжела Ромуальдовна
Телефон: 8 (017) 363-26-48 Каб.№401 Электронная почта: [email protected]
Первый заместитель директора Лащук Сергей Федорович
Телефон: 8 (017) 363-26-48 Каб.№415 Электронная почта: [email protected]
Заместитель директора Прудковский Вадим Олегович
Телефон: 8 (017) 363-26-48 Каб.№402 Электронная почта: [email protected]
Секретарь приёмной Кузнецова Жанна Александровна
Телефон: 8 (017) 363-26-48 Каб.№400 Электронная почта: [email protected]
Главный бухгалтер Ильина Наталья Ивановна

Телефон: 8 (017) 399-28-26 Каб.№414 Электронная почта: [email protected]
Начальник финансово-экономического управления Антонян Маро Араратовна
Телефон: 8 (017) 350-95-76 Каб.№416 Электронная почта: [email protected]
Заместитель начальника финансово-экономического управления Борщ Александр Игоревич
Телефон: 8 (017) 363-07-56 Каб.№411 Электронная почта: [email protected]
Заместитель начальника управления прослеживаемости животных Апацкая Валентина Сергеевна
Телефон: 8 (017) 363-07-54 Каб.№417 Электронная почта: [email protected]
Начальник управления управления идентификации и прослеживаемости продуктов животного происхождения Зайцева Елена Александровна
Телефон: 8 (017) 323-07-38 Каб.№417 Электронная почта: [email protected]
Заместитель начальника управления идентификации и прослеживаемости продуктов животного происхождения Марковская Екатерина Юрьевна
Телефон: 8 (017) 369-03-06, 8 (017) 369-04-06 Каб.№69 Электронная почта: [email protected]
Ведущий специалист по кадрам Кузнецова Диана Игоревна

Телефон: 8 (017) 320-75-29 Каб.№320 Электронная почта: [email protected]
Юрисконсульт Шавлюкевич Ирина Викторовна
Телефон: 8 (017) 379-97-91 Каб.№407 Электронная почта: [email protected]
Начальник управления по Брестской области Дубинская Елена Михайловна
Телефон: 8 (017) 363-07-58 Каб.№413 Электронная почта: [email protected]
Заместитель начальника управления по Брестской области Блинкова Кристина Эдуардовна
Телефон: 8 (017) 378-97-92 Каб.№404 Электронная почта: [email protected]
Начальник управления по Витебской области Азенова Инна Владимировна
Телефон: 8 (017) 374-75-19 Каб.№319 Электронная почта: [email protected]
Заместитель начальника управления по Витебской области Янукович Елена Викторовна
Телефон: 8 (017) 374-75-19 Каб.№319 Электронная почта: [email protected]
Начальник отдела учёта животных Ильющенко Злата Борисовна
Телефон: 8 (017) 378-96-06 Каб.№405 Электронная почта: [email protected]
Заместитель начальника управления по Гомельской области Верниковская Ирина Николаевна
Телефон: 8 (017) 378-96-06 Каб.№405 Электронная почта: [email protected]
Начальник управления по Гродненской области Бизук Янина Андреевна
Телефон: 8 (017) 360-38-90, 8 (017) 399-47-89 Каб.№37 Электронная почта: [email protected]
Заместитель начальника управления по Гродненской области Семашко Ирина Владимировна
Телефон: 8 (017) 399-47-89 Каб.№37 Электронная почта: [email protected]
Начальник управления по Минской области Павлють Татьяна Сергеевна

Телефон: 8 (017) 360-38-90 Каб.№37 Электронная почта: [email protected]
Заместитель начальника управления по Минской области Антоненко Кристина Витальевна
Телефон: 8 (017) 399-47-58 Каб.№37 Электронная почта: [email protected]
Начальник управления по Могилевской области Лебединская Елена Владимировна
Телефон: 8 (017) 360-39-01, 8 (017) 360-39-02 Каб.№403 Электронная почта: [email protected]
Заместитель начальника управления по Могилевской области Шелег Ангелина Дмитриевна

Телефон: 8 (017) 360-39-01, 8 (017) 360-39-02 Каб.№403 Электронная почта: [email protected]
Председатель профкома Апацкая Валентина Сергеевна
Телефон: 8 (017) 323-07-38 Каб.№417 Электронная почта: [email protected]
Ведущий администратор системный Купревич Алёна Михайловна
Телефон: 8 (017) 363-07-56 Каб.№411 Электронная почта: [email protected]

[email protected]
Факс 8(017) 365-02-51
Адрес: 220053, г.Минск, ул.Старовиленский тракт, 91

Беларусь прорабатывает вопрос отмены бумажных ветеринарных сертификатов

Беларусь прорабатывает вопрос отмены бумажных ветеринарных сертификатов

Беларусь прорабатывает вопрос отмены бумажных ветеринарных сертификатов, сообщил сегодня журналистам технический директор Межотраслевого научно-практического центра систем идентификации и электронных деловых операций Геннадий Волнистый в пресс-центре БЕЛТА.

«Идет к завершению взаимная интеграция информационных систем прослеживаемости животноводческой продукции — белорусской AITS и российской «Меркурий». Мы уже приняли порядка 600 электронных сертификатов из РФ на продукцию, которая отгружается в Беларусь. В третьем квартале планируем начать прием и предоставление российских электронных ветсертификатов на подконтрольную продукцию, которая отгружается в Беларусь из России, — сказал Геннадий Волнистый. — Мы стремимся к упразднению бумажных ветеринарных сертификатов на внутреннем рынке и работаем над решением этого вопроса. Буквально месяц назад пришло письмо из Россельхознадзора. Учитывая успешное техническое продвижение, они предлагают проработать вопрос об отмене бумажных сертификатов в формате взаимной торговли».

Начальник управления государственной ветеринарной инспекции Департамента ветеринарного и продовольственного надзора Минсельхозпрода Евгений Садыков отметил, что в Беларуси внедрена и активно развивается государственная информационная система идентификации, регистрации, прослеживаемости животных и продукции животного происхождения (ГИС AITS). Структурно она состоит из трех взаимосвязанных подсистем: «AITS-Животные» (для идентификации, регистрации и прослеживаемости животных), «AITS-Прослеживаемость» (для продуктов животного происхождения) и «AITS-Ветбезопасность» (для обеспечения ветеринарной безопасности подконтрольных продуктов).

«Предпосылкой для создания инфосистемы послужил статус нашей страны как экспортного государства, — рассказал представитель Минсельхозпрода. — Многие страны сейчас внедряют систему электронной ветеринарной сертификации, и нам она также необходима, в том числе для торговли в пределах ЕАЭС. Наша система сейчас проходит стадию активного развития. Она одна из самых современных, объемных, нагруженных в функциональном плане на просторах СНГ. Другие страны ЕАЭС проявляют к ней интерес. Начался тестовый период по выдаче электронных сертификатов на корма животного происхождения, продукцию технического назначения. Следующим шагом будет выдача электронных ветеринарных сертификатов на все подконтрольные грузы в Беларуси».

Научно-производственное объединение «Интеллектуальные технические системы»

Диапазон измерений скорости, км/чот 5 до 255
Пределы допускаемой абсолютной погрешности измерений скорости
в диапазоне от 5 до 100 км/ч±2 км/ч
в диапазоне от 100 до 255 км/ч±2%
Дискретность установки порогового значения скорости, км/ч1
Пределы допускаемой абсолютной погрешности привязки текущего времени комплекса к шкале UTC(SU), мс±1
Границы допускаемой абсолютной инструментальной погрешности (при доверительной вероятности 0,95) определения координат системы, м±5
Пределы допускаемой абсолютной погрешности измерений интервалов времени, С2
Количество сохраняемых ТС во встроенной памяти, шт.700 000
Наработка на отказ, часов36 000
Масса, кг, не более
блока управления12
распознающей камеры в кожухе5
кронштейна15
инфракрасного осветителя2
Габаритные размеры (длина × ширина × высо-та), мм, не более:
блок управления400 × 300 × 300
распознающая камера134 × 88 × 273
ИК осветитель150 × 300 × 300
Параметры электропитания:
напряжение переменного тока, В220 ± 10
частота, Гц50 ± 0,5
Потребляемая мощность комплекса Вт, для одной зоны контроля130
Рабочие условия эксплуатации:
атмосферное давление, кПа63 — 101
относительная влажность при температуреокружающего воздуха 30ºС, %95
температура окружающей среды, ºСот –40º до +60º
Высота установки, м
распознающей камеры5 — 11
обзорной камеры4,5 – 12
Размер зоны контроля:
длина, м 10 – 20
ширина, м 2,8 – 18
максимальная дальность, м70
расстояние от проекции точки установки РК на дорожное полотно до оси контролируемой полосы, не более м15
Диапазон углового расположения видеоустройства (по горизонтали) к вектору движения ТС по полосе, º30
Пределы допускаемой погрешности определения мгновенных координат цели:
дальность, м1
угол, º2
Степень защиты, IP65
Срок службы, лет6
Удаленная техническая поддержка производителяс помощью канала связиGSM, 3G, 4G, LTE, Ethernet

5. Мероприятия управления Информационной безопасностью. Информационная безопасность ОАО «РЖД»

Похожие главы из других работ:

Администрирование баз данных

3. Управление безопасностью в системах управления базами данных

Системы управления базами данных являются ключевым инструментом, обеспечивающим хранение больших массивов информации. Современные информационные приложения выстраиваются для работы в многопользовательских системах…

Администрирование базы данных

2.3 Управление безопасностью в СУБД

Системы управления базами данных стали основным инструментом, обеспечивающим хранение больших массивов информации. Современные информационные приложения опираются, как уже говорилось, в первую очередь, на многопользовательские СУБД…

Безопасность компьютерных сетей

2. Управление безопасностью сетей

В настоящее время в большинстве небольших коммерческих фирм обязанности по администрированию сети и обязанности по обеспечению информационной безопасности возложены на плечи одного человека: как правило, это администратор сети…

Информационная безопасность ОАО «РЖД»

4. Система управления информационной безопасностью (СУИБ)

В подразделениях аппарата управления…

Информационная система управления и обслуживания сети котельных

3. Архитектура информационной системы управления и обслуживания сети котельных

Архитектура информационной системы — это концептуальное описание структуры, определяющее модель, выполняемые функции и взаимосвязь компонентов информационной системы [2]…

Информационные технологии в профессиональной деятельности

1.6 Состав информационной технологии управления

Для информатизации общества и бизнеса необходим широкий спектр программно-аппаратных средств, в том числе вычислительной техники и средств связи…

Информационные технологии в управлении АКБ «Фора-Банк» (ЗАО)

2.2 Характеристика информационной системы управления деятельностью АКБ «Фора-Банк»

В исследуемом мной АКБ «Фора-Банк» используется информационная автоматизированная система Diasoft. Используется она уже на протяжении многих лет, существенно облегчает работу…

Использование типовых программных компонентов в системах управления предприятиями

1.1 Понятие информационной системы управления предприятием

Любой экономический объект (предприятие, организация, фирма) является сложной, динамичной и управляемой системой. Система — это упорядоченная совокупность разнородных элементов или частей, взаимодействующих между собой и с внешней средой…

Обеспечение защиты данных в подсистеме «Учет распределения товара»

4. Организационные мероприятия, направленные на повышение уровня информационной безопасности на предприятии

Проведение организационных мероприятий является не только наиболее эффективным, но и дешевым средством защиты информации…

Обеспечение информационного туннеля на многокарточных координаторах

1.3.4 Управление безопасностью сети

Сети VРN интегрируют как сами сетевые устройства, так и многочисленные сервисы управления безопасностью и пропускной способностью. Компаниям необходимо целостное управление этими устройствами и сервисами через инфраструктуру VРN…

Обнаружение атак. Поиск уязвимостей компонентов информационной системы

1. КОНЦЕПЦИЯ АДАПТИВНОГО УПРАВЛЕНИЯ БЕЗОПАСНОСТЬЮ

Обнаружение атак. Поиск уязвимостей компонентов информационной системы

1.2 Адаптивное управление безопасностью

В большинстве случаев для решения возникающих проблем с защитой в организациях используются частичные подходы. Эти подходы обычно обусловлены прежде всего текущим уровнем доступных ресурсов. Кроме того…

Оптимизация ОС Windows Vista с целью обеспечения информационной безопасности

Централизованное управление безопасностью

До включения Центра безопасности в состав Windows XP Service Pack 2 (SP2) настройка всех параметров безопасности Windows была нелегким делом. Теперь же Центр безопасности — это единое место…

Роль информационных систем в бюджетном процессе

4. Структура автоматизированной информационной системы управления бюджетным процессом

Управление бюджетным процессом осуществляется в масштабах распределенной инфраструктуры, основным элементом которой является бюджетная статья. Эта распределенная структура технически представляет собой распределенную сеть…

Совершенствование информационной системы товарооборота ООО «Уралэнергоцентр» с помощью разработки базы данных

3.2 Разработка автоматизированной информационной системы управления ООО «Уралэнергоцентр»

Система визуального программирования Delphi обладает большой популярностью среди широкого круга пользователей: от не специалистов до системных программистов, занимающихся разработкой сложных приложений и информационных систем…

Зачем чипируют сельхозживотных

Коровам – бирки-«сережки», лошадям – микрочипы, свиньям – татуировки. Нет, это не украшения для сельхозживотных, а реализация системы по их учету, которая действует в нашей стране. В скором времени она может несколько измениться.

На весенней сессии депутаты Палаты представителей планируют рассмотреть в первом чтении поправки в закон «Об идентификации, регистрации, прослеживаемости сельскохозяйственных животных (стад), идентификации и прослеживаемости продуктов животного происхождения». Об этом сообщает Белорусское телеграфное агентство со ссылкой на члена Постоянной комиссии по аграрной политике Александра Левчука. Предлагается расширить перечень животных, подлежащих таким процедурам. Ожидается, что его дополнят пушными зверями, кроликами, птицей, рыбой и некоторыми другими. Кроме того, одна из задач – наладить четкую прослеживаемость, чтобы не только специалисты, но и покупатели могли узнать интересующую их информацию о происхождении продукта.

Сейчас, по словам главного ветеринарного врача Гродненского района Сергея Кравцевича, при помощи информационной системы «АИТС-Прослеживаемость» есть возможность узнать, мясо каких конкретно особей, партий животных было использовано для получения изделия. Для этого достаточно отсканировать штрих-код на той же колбасе, а программа уже отобразит имеющуюся информацию. Это позволяет оценить то, насколько доброкачественное, безопасное сырье применялось.

К слову, с применением «АИТС-Ветбезопасность» осуществляется выдача ветеринарных сопроводительных документов на перемещаемый внутри страны и за ее пределы скот и продукцию животного происхождения.

Сергей Кравцевич отмечает, что крупный и мелкий рогатый скот (коровы, козы, овцы) идентифицируется при помощи бирок, которые крепятся на ушах. Такой метод применялся и ранее, но в последние годы используются «сережки» не только с номером, но и специальным штрих-кодом, который можно отсканировать, чтобы узнать всё о животном. Свиньи, как правило, маркируются групповым методом и получают татуировку с необходимой информацией на наружной поверхности бедра, а вот лошади – микрочип в середине шеи под гривой. Каждый идентификационный номер уникальный. То есть просто взять и поменять те же бирки у коров нельзя, как, впрочем, и перевесить с павшей на живую.

На буренку с «сережками» в ушах, как и на других животных, прошедших идентификацию, заводится электронный паспорт в информационной системе «АИТС». В него заносится вся информация, начиная с рождения и до последних дней жизни. Там, например, фиксируются данные о лечебных и профилактических мероприятиях, кто и кому реализовал сельхозживотное, где оно содержалось и многое другое.

Полный материал читайте в электронной версии газеты «Перспектива» (№26).

Врач лечит человека, а ветврач – все человечество — Единство

Длительное время Борисовский район благополучен по остро протекающим инфекционным и инвазионным заболеваниям животных. Снижается их непроизводительное выбытие (падеж и вынужденный убой). О планомерной и постоянной работе по совершенствованию ветеринарного обслуживания хозяйств, которая привела коллектив ГУ «Борисовская райветстанция» к заслуженно высокой оценке его деятельности, беседуем с начальником учреждения Н.В. Орленком.

— Николай Владимирович, проведите, пожалуйста, небольшой экскурс в профессию государственного ветеринарного врача.

— Чтобы стать хорошим специалистом, недостаточно только глубоких знаний. Без любви к животным в нашей профессии вообще делать нечего. Как и без умения сострадать, без обостренного чувства ответственности, желания самосовершенствоваться и развиваться.

Спектр деятельности ветеринарных специалистов широк: от мониторинговых обследований до проведения лечебных мероприятий. При этом они постоянно работают с животными: проводят их обследование и лечение, профилактику болезней конечностей, вакцинацию, исследования на маститы; отбирают материал для лабораторных исследований; в отделе лабораторной диагностики изготавливают лечебно-диетические препараты; проводят инспекторскую работу.

Специалисты вносят информацию о проведении профилактических и лечебных ветеринарных мероприятий в систему АИТС (система идентификации и прослеживаемости животных и продукции животного происхождения). При этом оформление и выдача ветеринарных свидетельств и сертификатов производятся в данной системе регистрации электронных документов.

— Задач много. Специалистов хватает?

— В самой райветстанции достаточно. А вот в отдельных сельскохозяйственных организациях не хватает. Имеются вакансии.

— Есть ли возможность у сотрудников повышать свою квалификацию?

— Безусловно. Не реже раза в три года ветеринарных специалистов направляем на курсы повышения квалификации.

— Какие услуги ваших специалистов наиболее востребованы у населения?

— С момента перехода на летне-пастбищный период содержания животных проводим мероприятия по профилактике лейкоза, бруцеллеза, туберкулеза крупного рогатого скота. Этим занимаются несколько мобильных бригад. Они же осуществляют забор крови животных для исследований, туберкулинизацию, обработку против гнуса. И, конечно же, лечат заболевших животных.

Особое внимание уделяем иммунизации животных против более десяти инфекционных заболеваний.

— Какие болезни животных наиболее часто встречаются в районе?

— У животных, переболевших в раннем возрасте, отмечается значительное отставание в развитии, их организм не способен в полной мере усваивать питательные вещества, которые содержатся в кормах. Если среднесуточный прирост массы здоровых телят составляет 700-800 г, то переболевших — всего 400-480 г.

Часто среди молодняка крупного рогатого скота встречаются болезни органов пищеварения, дыхания, сердечно-сосудистые заболевания, травмы. У коров регистрируются болезни конечностей.

Бывают и неординарные случаи. Недавно на ферме в Неманице в ОАО «Лошницкий край» корова не могла растелиться. Ветеринарный врач Иван Елиневич провел операцию — кесарево сечение и спас и корову, и теленка.

— В любой отрасли есть задачи, выполнение которых позволяет идти вперед. Что из намеченного удалось воплотить в жизнь?

— Благодарны Борисовскому райисполкому за должное финансирование. Сами стараемся зарабатывать — оказываем платные услуги населению и сельскохозяйственным организациям. В итоге за последние годы обновили автомобильный парк райветстанции, провели ремонт фасада здания и гаражей. Приобрели новое оборудование, компьютерную технику, аппарат для выполнения побелки помещений в хозяйствах района. В ближайшее время планируется закупка дезинфекционной установки «Кобра». Выросла заработная плата специалистов.

— Поделитесь, пожалуйста, планами.

— Предстоит дальнейшее укрепление материально-технической базы райветстанции, модернизация отдела лабораторной диагностики, совершенствование системы идентификации животных.

— Спасибо за беседу.

Беседовал Евгений АЛПАТОВ

Дипломная работа (Проблемы экономической безопасности железнодорожного транспорта в условиях реформирования отрасли), страница 13

Система обеспечения информационной безопасности ОАО «РЖД» представляет собой сложную организационно-техническую систему, закрепленной Стандартом ОАО «РЖД» «Управление Информационной Безопасностью. Общие положения», утвержденным распоряжением ОАО «РЖД» от 11.03.2009 N 480р.

Стандарт устанавливает: задачи и принципы построения системы управления информационной безопасностью, требования к организационной структуре и мерам управления информационной безопасностью, требования к нормативной и методической документации по управлению информационной безопасностью, принципы организации планирования мероприятий по управлению информационной безопасностью, основные меры управления информационной безопасностью ОАО «РЖД» [3].

Информационной безопасностью ОАО «РЖД» занимаются ООО «Центр безопасности информации», ОАО «Научно-исследовательский и проектно-конструкторский Институт информатизации, автоматизации и связи на железнодорожном транспорте» дочернее предприятие ОАО «РЖД» и другие.

Основными целями создания и функционирования Системы информационной безопасности являются обеспечение защиты информации, не относящейся к категории «государственная тайна», внедрение и эксплуатация технических подсистем, комплексов и средств обеспечения информационной безопасности, обеспечение доступности соответствующих категорий информации для пользователей ОАО «РЖД», других организаций и частных лиц, управление информационной инфраструктурой, а также аудит уровня информационной безопасности ОАО «РЖД» [3,37].

Основными задачами управления информационной безопасностью являются:

1. выполнение требований законодательства и нормативных документов уполномоченных в области обеспечения ИБ государственных органов;

2. обеспечение информационной безопасности ОАО «РЖД» при обработке и использовании информационных активов компании;

3. определение информационных активов ОАО «РЖД», подлежащих защите;

4. определение категорий автоматизированной информационной и телекоммуникационной системы и информационных активов ОАО «РЖД» с целью определения приоритетов и требуемых уровней защиты информации;

5. анализ уязвимостей, построение моделей нарушителей и угроз безопасности информационных активов;

6. анализ и оценка рисков нарушения категорий автоматизированной информационной и телекоммуникационной системы и информационных активов ОАО «РЖД»;

7. определение рационального баланса технических и организационных мер обеспечения безопасности информации;

8. разработка и внедрение системы управления в компанию;

9. обеспечение взаимоувязанного по времени, целям и задачам взаимодействия структурных подразделений защиты информации;

10. взаимодействие с уполномоченными в области обеспечения информационной безопасности государственными органами в ходе проведения проверок, инспекций и по текущим вопросам обеспечения информационной безопасности [3,37].

Основными принципами управления информационной безопасностью являются:

1. законность — соответствие правовым нормам;

2. достаточность и нормирование защиты — реализация технически и экономически обоснованных уровней информационной безопасности и мер защиты;

3. базирование на рисках — выбор уровня, требований и мер информационной безопасности основывается на результатах анализа и оценки рисков реализации угроз безопасности информационным активам ОАО «РЖД»;

4. надежность — сохранение безопасного состояния в случае сбоев системы;

5. соразмерность затрат на защиту — затраты на обеспечение безопасности не должны превышать величину возможного ущерба, связанного с нарушением системы;

6. простота — меры и механизмы обеспечения информационной безопасности должны быть насколько это возможно простыми;

7. контроль доступа (управление доступом) — доступ к информации должен осуществляться только с использованием средств, реализующих политику разграничения доступа;

8. открытость — безопасность компании не должна зависеть от мер по ограничению доступа к информации относительно реализации компонентов соответствующих систем обеспечения;

9. разделение прав — функции безопасности, используемых в ОАО «РЖД», должны быть разделены между подсистемами, их реализующими; роли администраторов, операторов и пользователей системы должны быть разделены между персоналом компании;

10. приемлемость — пользователи системы должны осознавать необходимость в обеспечении информационной безопасности, а также участвовать в регулярных тренировках и проходить обучение по вопросам организации информационной безопасности.

11. многоуровневая защита – механизмы обеспечения системы должны применяться на нескольких уровнях защиты таким образом, что компрометация одного механизма безопасности не являлась бы достаточным условием компрометации системы или какой-либо ее части;

12. регистрация нарушений безопасности – нарушения должны регистрироваться в соответствующих электронных журналах;

13. непрерывность защиты — обеспечение безопасности производится на всех стадиях и этапах жизненного цикла системы;

14. периодическая оценка — требования и меры по обеспечению информационной безопасности периодически контролируются, пересматриваются и переоцениваются.

К основным объектам защиты информации в ОАО «РЖД» относятся [3]:

1. объекты информационной инфраструктуры, включающие в себя программно-технические комплексы и систему управления единой магистральной цифровой сетью связи;

2. системы управления автоматических телефонных станций обще-технологической и оперативно-технологической сетей;

3. программно-технические комплексы и система управления сетью передачи данных;

4. объекты автоматизированных систем управления и информационных систем, включающие в себя отдельные автоматизированные рабочие места и локальные вычислительные сети, серверные сегменты информационных систем и автоматизированных систем управления, программно-технические комплексы поддержания специализированных баз данных;

5. системы документооборота.

Система информационной безопасности состоит из трех основополагающих компонентов: организационный, нормативно-правовой и технический [3,37].

В роли организационного компонента выступают все должностные лица и штатные подразделения обеспечения системы информационной безопасности.

Нормативно-правовой компонент разрабатывается на основе действующих в Российской Федерации законодательных и нормативных документов и международных стандартов: ГОСТ Р 51275-99; ГОСТ Р 51624-2000; ГОСТ Р 51583-2000; ГОСТ Р ИСО/МЭК 15408-2002; ISO/IEC 17799:2005; ISO/IEC 27001:2005 и др.

Среди основных направлений формирования нормативно-методической базы следует выделить разработку корпоративного стандарта управления информационной безопасностью, политика информационной безопасности компании, положений, руководств, регламентов, методик, профилей защиты, заданий по безопасности [3,37].

В качестве примеров нормативных актов можно привести «Инструкцию о порядке обращения с информацией, составляющей коммерческую тайну ОАО «РЖД», «Перечень сведений, составляющих коммерческую тайну ОАО «РЖД», распоряжение «Об организации работ по предотвращению записи, хранения и распространения информации и программных продуктов непроизводственного характера» с «Примерным перечнем категорий информации и программных продуктов…» и «Примерным порядком организации создания корпоративных Web-сайтов, FTP-серверов, конференций…», «Порядок подключения пользователей к информационным ресурсам ОАО «РЖД» и ряд других.

Техническим компонентом является корпоративная инфо-телекоммуникационная сеть ОАО «РЖД». Данная сеть объединяет информационные ресурсы и технические средства обработки и передачи информации центрального аппарата, железных дорог и других филиалов РЖД.

Важнейшими техническими компонентами инфосистемы ОАО «РЖД» являются СПД и ЕМЦСС. В настоящее время введены в действие комплекс защиты системы управления ЕМЦСС и комплекс защиты СПД магистрального и дорожного уровней, обеспечивающие регистрацию, учет и целостность ПО и обрабатываемой информации, разграничение доступа к ресурсам, аудит событий безопасности и обнаружение вторжений [3,37].

Еще одним техническим компонентом, во многом определяющим ИБ, является инфраструктура Windows-доменов и Active Directory (AD), которая дает возможность централизованного формирования и управления политиками безопасности информационных систем. Здесь же следует упомянуть и инфраструктуру открытых ключей, находящуюся в стадии формирования и предназначенную для усиленной аутентификации и авторизации доступа к информационным ресурсам функционирования VPN-каналов, а также реализации шифрования и электронной цифровой подписи при внутреннем информационном обмене [3,37].

К другим техническим компонентам Системы обеспечения информационной безопасности относится комплекс защиты от разрушающих программных воздействий и обновлений ПО, поддерживающий оперативную рассылку обновлений антивирусных баз и системного программного обеспечения по всей сети филиалов компании.

Работы по развитию Системы обеспечения информационной безопасности в совокупности обеспечивают необходимый базовый уровень информационной безопасности ОАО «РЖД» и снижают вероятность реализации угроз [3,37].

К мероприятиям управления информационной безопасностью, подлежащим реализации в ОАО «РЖД», относятся следующие:

— активная поддержка процессов информационной безопасности со стороны руководства ОАО «РЖД»;

— координация деятельности, связанной с информационной безопасностью;

— четкое распределение и разделение обязанностей, связанных с информационной безопасностью;

— инвентаризация всех значимых информационных активов;

— оценка значимости и категорирование информационных активов и АИТС;

— эффективная организация информационных активов и АИТС;

— анализ уязвимостей, формирование перечней угроз и характеристик вероятных нарушителей;

— анализ и оценка рисков нарушения информационной безопасности;

— эффективное проектирование мер, средств и систем обеспечения информационной безопасности;

— документирование должностных обязанностей персонала;

— проведение регулярного обучения персонала;

— определение мер дисциплинарного характера к нарушителям;

— проведение предупредительных мероприятий при увольнении сотрудников ОАО «РЖД»;

— физическая защита средств хранения и обработки информации;

— резервирование электропитания для критичных ресурсов;

— защита (контроль) кабелей электропитания и телекоммуникационных кабелей;

— надлежащее регламентное обслуживание оборудования;

— контроль за перемещением оборудования;

— надлежащее документирование эксплуатационных процедур;

— разделение средств разработки, средств тестирования от эксплуатируемых средств обработки информации;

— мониторинг производительности ресурсов АИТС и поддержание необходимых эксплуатационных характеристик АИТС в случаях их масштабирования;

— наличие единых требований при разработке новых АИТС, модернизации существующих АИТС;

— контроль за включением в АИТС новых средств обработки информации, а также за модификацией (заменой) используемых;

— применение надлежащих методов идентификации и аутентификации;

— разграничение доступа пользователей к ресурсам АИТС и документирование процедур предоставления доступа пользователей к ресурсам АИТС;

— защита от компьютерных вирусов и вредоносного программного обеспечения;

— осуществление регламентного резервного копирования информации;

— реализация мер управления информационной безопасностью в вычислительных сетях;

— защита передаваемой информации;

— реализация надлежащих процедур управления съемными носителями информации;

— реализация мероприятий по защите персональных данных при их обработке в АИТС ОАО «РЖД»;

— реализация мониторинга информационной безопасности и обеспечение аудита событий;

— периодическое проведение внутреннего аудита;

— реализация технологии «поддержки доверия» к оцененным (аттестованным) по требованиям информационной безопасности АИТС;

— периодический независимый анализ (оценка) состояния информационной безопасности в ОАО «РЖД».

Угрозы информационной безопасности можно разделить на внутренние и внешние.

К внутренним угрозам относятся действия или бездействия (в том числе умышленные и неумышленные) сотрудников предприятия, противоречащие интересам его коммерческой деятельности, следствием которых могут быть нанесение экономического ущерба компании, утечка или утрата информационных ресурсов (в том числе сведений, составляющих коммерческую тайну и/или конфиденциальную информацию), подрыв ее делового имиджа в бизнес-кругах, возникновение проблем во взаимоотношениях с реальными и потенциальными партнерами (вплоть до утраты важных контрактов), конфликтных ситуаций с представителями криминальной среды, конкурентами, контролирующими и правоохранительными органами, производственный травматизм или гибель персонала и т.д. [37].

AMIS AIT-V (CSRA) | GDIT

AMIS AIT-V (CSRA)

О технологии автоматической идентификации V (AIT-V)

Решения для автоматизированного перемещения и идентификации

Армия США Автоматизированные решения по перемещению и идентификации (AMIS) заключила партнерские отношения с CSRA для поддержки технологии автоматической идентификации V (AIT-V) с неограниченной доставкой / неопределенным количеством (IDIQ), конкурентоспособного контракта с несколькими поставщиками и несколькими присуждениями, в результате чего CSRA стала единый провайдер, утвержденный наградой для решений AIT-V во всем министерстве армии.

Цели AIT-V

Цель AIT-V IDIQ — предоставить современную, общую, интегрированную структуру для логистической идентификации, отслеживания, определения местоположения и мониторинга товаров и активов. Кроме того, маркировка уникальной идентификации предмета (IUID), сбор данных, информация о хранении, методы поиска, обработка информации и передача данных тегов значительно улучшат системы в рамках Министерства обороны (DoD), береговой охраны США, других федеральных агентств, Организация Североатлантического договора (НАТО), партнеры по коалиции и другие военные поставки за рубеж (FMS).Технология пассивной RFID обеспечит стандартизацию и взаимодействие между государственными пользователями пассивного оборудования RFID и дополнительных услуг, приобретенных по контракту AIT-V.

Руководство по поддержке служб и оборудования AIT-V IDIQ

Услуги поддержки в рамках AIT-V IDIQ

Теперь доступно: Руководство пользователя AIT-V. Это руководство пользователя содержит продукты и предложения CSRA AIT-V и доступно в виде загружаемого файла PDF. Это руководство представляет собой простой и понятный документ, который позволяет пользователям заказывать и создавать конфигурации, отвечающие их потребностям.

Процедура отправки гарантийного и технического обслуживания оборудования
  1. Перед тем, как обращаться к нам за обслуживанием, убедитесь, что у вас есть следующая информация:

    а. Модель объекта, требующего обслуживания
    b. Серийный номер устройства, требующего обслуживания
    c. Контактное лицо
    d. Контактный телефон
    e. Адрес, где находятся подразделения, требующие обслуживания
    f. Краткое описание проблемы, с которой вы столкнулись

  2. Обратитесь в сервисный центр для запроса обслуживания.
  3. Специалисты по обслуживанию позвонят пользователям, чтобы определить, требуется ли возврат устройства (ей).

    а. Если проблема может быть решена по телефону, заявка на обслуживание закрывается.
    г. Если проблема требует, чтобы устройство (а) было возвращено, пользователю выдается номер разрешения на возврат материалов (RMA) и этикетка возврата UPS.
    я. Единицы получены и проверены II. Ремонт агрегата (ов) iii. Единицы устанавливаются поэтапно в соответствии с требованиями контракта iv. Единицы возвращаются пользователю — укажите адрес, если он отличается от места получения.

Ремонтная служба

Для агрегатов, требующих возврата для ремонта, обратите внимание на следующее:

  • Отправляйте единицу в оригинальной упаковке или в аналогичной, чтобы избежать повреждений при транспортировке
  • Опции не должны быть возвращены вместе с агрегатом, если они не требуются для ремонта или оценки
  • Ленты и этикетки должны быть удалены с принтеров перед отправкой, но образцы должны быть предоставлены для целей тестирования
  • Номер RMA должен быть указан снаружи упаковки и на упаковочном листе
  • Батареи должны быть удалены перед транспортировкой терминалов

Процесс заказа задания

Заказ продуктов в AIT IDIQ
  • Команда CSRA будет работать с вами, чтобы гарантировать, что ваши требования AIT будут хорошо поняты и правильно спроектированы.Наши инженеры реализовали сотни установок DOD и коммерческих AIT, и, при необходимости, наша команда может использовать полученные уроки для проверки компонентов решения AIT.
  • Сейчас в наличии: Руководство пользователя AIT. Это руководство пользователя содержит продукты и предложения CSRA AIT и доступно в виде загружаемого файла PDF.
  • Чтобы разместить заказ или для отслеживания заказа, свяжитесь с командой AIT IDIQ по телефону: (703) 224-3866 или по электронной почте: AIT Help
Области задач и возможности

Просмотр продуктов

Дополнительные документы

Идентификация языка текста — на cAInvas | от AI Technology & Systems | AITS Journal

Определите язык заданных текстовых данных с помощью глубоких нейронных сетей.

Фото Pendar Yousefi на Dribbble

Обнаружение языка относится к определению языка, на котором написан данный текст. Это проблема категоризации текста по сути, причем языки являются классами.

Эта категоризация становится важной, когда язык входных данных не предполагается. Например, функция определения языка в Google Translate определяет язык вводимого текста перед его переводом.

В этой статье мы классифицируем текстовые данные на 22 языка — арабский, китайский, голландский, английский, эстонский, французский, хинди, индонезийский, японский, корейский, латынь, персидский, португальский, пушту, румынский, русский, испанский, шведский, Тамильский, тайский, турецкий, урду.

Реализация идеи на cAInvas — здесь!

On Kaggle, автор Zara Jamshaid

WiLI-2018, эталонный набор данных по идентификации языков Википедии, содержащий 235000 абзацев на 235 языках.

После выбора данных и предварительной обработки 22 языка из исходного набора данных были выбраны для создания текущего набора данных.

Каждый язык в этом наборе данных содержит 1000 строк / абзацев. Набор данных представляет собой CSV-файл, состоящий из 1000 образцов текста на 22 языках каждый, что составляет в общей сложности 22 тыс. Образцов в наборе данных.

Снимок набора данных

Взгляд на разброс значений по классам —

Распределение значений по классам

Это идеально сбалансированный набор данных.

Вот один пример текста на каждом языке из набора данных —

Образцы (1/2) Образцы (2/2)

Если мы внимательно рассмотрим образцы, мы увидим, что в образце урду мало английских слов и транслитерированные слова тоже на тайском языке! Это может привести к неоднозначности во время прогнозирования.

Одно горячее кодирование

Это проблема классификации нескольких классов, когда классы не имеют зависимости от диапазона. Таким образом, языки кодируются в горячем режиме для целей классификации.

Это делается с помощью функции get_dummies () модуля pandas. Drop_first остается False, поскольку эта кодировка предназначена для меток классов.

Столбцы закодированного кадра данных столбца сохраняются, чтобы помочь в декодировании значений выходного класса позже.

Одно горячее кодирование меток классов Снимок кадра данных после однократного горячего кодирования

Пакет кодирования слов

Модель пакета слов представляет множество слов в предложении.Грамматика или порядок слов значения не имеют.

Для реализации используется функция CountVectorizer () модуля sklearn.feature_extraction.text. Используются только 1-граммовые (одно слово) токены, а количество извлеченных функций ограничено 20000. Поскольку логически обучающий набор — это единственные данные, которые нам разрешено видеть или работать с ними во время обучения модели, в то время как используются два других. Чтобы настроить / оценить его производительность, эта модель подходит для обучающих текстовых данных и используется для преобразования всех трех наборов текстовых данных — обучения, проверки и тестирования.

Модель мешка слов на текстовых данных

Разделение на проверку-проверка-поезд

Использование соотношения 80–10–10 для разделения фрейма данных на наборы проверки проверки-обучения. Затем они делятся на X и y (вход и выход) для дальнейшей обработки.

Разделение Train-val-test

Стандартизация

Стандартизация помогает центрировать и масштабировать значения, чтобы получить среднее значение 0 и стандартную дисперсию 1. Это гарантирует, что ни одна из функций не получит более высокий вес по сравнению с другими.

Функция StandardScaler в sklearn.Модуль предварительной обработки используется для реализации этой концепции. Подобно пакету кодирования слов, экземпляр соответствует обучающим данным и используется для преобразования обучающих, проверочных и тестовых данных.

Стандартизация значений разреженного массива

Модель представляет собой простую модель с 4 плотными слоями, 3 из которых имеют функции активации ReLU, а последний имеет функцию активации Softmax для преобразования значений последнего слоя в распределение вероятностей.

Модель скомпилирована с использованием категориальной функции кросс-энтропийных потерь, поскольку последний уровень модели имеет функцию активации softmax, а метки закодированы в горячем режиме.Используется оптимизатор Adam, и точность модели отслеживается по эпохам.

Функция обратного вызова EarlyStopping отслеживает потерю проверки и останавливает обучение, если она не уменьшается в течение 5 периодов непрерывно. Параметр restore_best_weights гарантирует, что модель с наименьшими потерями при проверке будет восстановлена ​​в переменной модели.

Обучение модели

Модель была обучена сначала со скоростью обучения 0,001, а затем со скоростью обучения 0,0001.

Модель достигла точности ~ 94.7% на тестовой выборке.

Результаты тестовых данных

Чем больше набор данных, тем лучше результаты.

Построение матрицы неточностей для лучшего понимания результатов —

Матрица неточностей

Мы видим, что 3% текстов на урду были предсказаны на английском языке. Это может быть связано с расхождениями, которые мы видели ранее в значениях набора данных.

График точности График потерь

Давайте выполним прогнозы на случайных выборках тестовых данных —

Код для прогнозирования на случайных выборках Случайная выборка из тестового набора

Библиотека, компилятор и структура вывода deepC предназначены для включения и выполнения глубокого обучения нейронные сети, сосредоточив внимание на особенностях устройств малого форм-фактора, таких как микроконтроллеры, eFPGA, процессоры и другие встроенные устройства, такие как raspberry-pi, odroid, Arduino, SparkFun Edge, RISC-V, мобильные телефоны, ноутбуки x86 и arm, среди прочего .

Компиляция модели с использованием deepC —

компиляция deepC

Перейдите на платформу cAInvas (ссылка на записную книжку приведена ранее) и проверьте прогнозы в файле .exe!

Кредиты: Ayisha D

AITS Значения | Что означает AITS?

9018 Автоматизированная система отслеживания Информационная система 902 69 000

Agency Information Technology Services

Расширенный интерфейс для тактической безопасности

Подтвержденная служба передачи информации

Система отслеживания действий

Услуги передовых информационных технологий

Annamacharya Institute of Technology & Sciences + 2 варианта

Технологический институт Аннамачарья и и наука s

Аравалиский институт технических исследований

Институт технологических наук им. Абдулкалама

Поддержка академических и учебных технологий

Академические услуги в области информационных технологий Исследования

Схема обучения аккредитованных интервьюеров

Адаптированные стандарты информационных технологий

Службы административных информационных технологий

Политика конфиденциальности — AITS.

Настоящая Политика конфиденциальности регулирует способ, которым AFFLUENT IT SERVICES собирает, использует, поддерживает и раскрывает информацию, полученную от пользователей (каждый, «Пользователь») веб-сайта http://www.aits.ooo («Сайт»).

Личная идентификационная информация

Мы можем собирать личную идентификационную информацию от пользователей различными способами, включая, помимо прочего, когда пользователи посещают наш сайт, регистрируются на сайте, размещают заказ, заполняют форму и в связи с другими действиями, услугами. , функции или ресурсы, которые мы предоставляем на нашем Сайте.При необходимости у пользователей могут быть запрошены имя, адрес электронной почты, номер телефона. Однако пользователи могут посещать наш сайт анонимно. Мы будем собирать личную идентификационную информацию от пользователей, только если они добровольно предоставят нам такую ​​информацию. Пользователи всегда могут отказаться предоставлять личную идентификационную информацию, за исключением того, что это может помешать им участвовать в определенных действиях, связанных с Сайтом.

Неличная идентификационная информация

Мы можем собирать неличную идентификационную информацию о пользователях всякий раз, когда они взаимодействуют с нашим сайтом.Неличная идентификационная информация может включать имя браузера, тип компьютера и техническую информацию о средствах подключения пользователей к нашему сайту, таких как операционная система и используемые поставщики интернет-услуг, а также другую подобную информацию.

Файлы cookie веб-браузера

Наш сайт может использовать файлы cookie для улучшения взаимодействия с пользователем. Веб-браузер пользователя размещает файлы cookie на их жестком диске для ведения учета, а иногда и для отслеживания информации о них.Пользователь может настроить свой веб-браузер так, чтобы он отказывался от файлов cookie или предупреждал вас об отправке файлов cookie. Если они это сделают, обратите внимание, что некоторые части Сайта могут работать некорректно.

Как мы используем собранную информацию

AFFLUENT IT SERVICES может собирать и использовать личную информацию пользователей для следующих целей:

  • Для запуска и работы нашего Сайта
    Нам может потребоваться, чтобы ваша информация отображала контент на Сайте правильно.
  • Для улучшения обслуживания клиентов
    Предоставляемая вами информация помогает нам более эффективно реагировать на ваши запросы в службу поддержки и поддержку.
  • Для персонализации взаимодействия с пользователем
    Мы можем использовать информацию в совокупности, чтобы понять, как наши Пользователи как группа используют услуги и ресурсы, предоставляемые на нашем Сайте.
  • Для улучшения нашего Сайта
    Мы можем использовать ваши отзывы для улучшения наших продуктов и услуг.
  • Для периодической отправки электронных писем
    Мы можем использовать адрес электронной почты для отправки информации о пользователях и обновлений, касающихся их заказа. Его также можно использовать для ответа на их запросы, вопросы и / или другие запросы.

Как мы защищаем вашу информацию

Мы применяем соответствующие методы сбора, хранения и обработки данных, а также меры безопасности для защиты от несанкционированного доступа, изменения, раскрытия или уничтожения вашей личной информации, имени пользователя, пароля, информации о транзакциях и данных, хранящихся на нашем Сайте.

Предоставление личной информации

Мы не продаем, не обмениваем и не сдаем в аренду личную идентификационную информацию пользователей третьим лицам.Мы можем передавать общую агрегированную демографическую информацию, не связанную с какой-либо личной идентификационной информацией о посетителях и пользователях, нашим деловым партнерам, доверенным аффилированным лицам и рекламодателям для целей, изложенных выше.

Электронные информационные бюллетени

Если Пользователь решит подписаться на наш список рассылки, он будет получать электронные письма, которые могут включать в себя новости компании, обновления, информацию о связанных продуктах или услугах и т. Д.

Изменения в этой политике конфиденциальности

AFFLUENT IT SERVICES имеет право по своему усмотрению обновить эту политику конфиденциальности в любое время.Когда мы это сделаем, мы разместим уведомление на главной странице нашего Сайта. Мы рекомендуем пользователям часто проверять эту страницу на предмет изменений, чтобы оставаться в курсе того, как мы помогаем защитить личную информацию, которую мы собираем. Вы признаете и соглашаетесь с тем, что вы обязаны периодически просматривать эту политику конфиденциальности и узнавать об изменениях.

Вы принимаете эти условия

Используя этот Сайт, вы подтверждаете свое согласие с этой политикой. Если вы не согласны с этой политикой, пожалуйста, не используйте наш Сайт.Дальнейшее использование вами Сайта после публикации изменений в этой политике будет считаться вашим согласием с этими изменениями.

Как с нами связаться

Если у вас есть какие-либо вопросы об этой Политике конфиденциальности, практике этого сайта или ваших отношениях с этим сайтом, пожалуйста, свяжитесь с нами по адресу [email protected] .

Необходимость локализации пользователей и анонимной идентификации лиц с ограниченными возможностями

[13] В. Миланес, Д. Ф. Льорка, Дж.Villagr´

a, J. P´

erez, I. Parra, C. Gonz´

alez,

и MA Sotelo, «Система активной безопасности на основе технического зрения для автоматического останова

», Экспертные системы с приложениями , т. 39, нет. 12. С. 11234–

11 242, 2012.

[14] Ю. Малиновский, Ю.-Ж. Ву и Ю. Х. Ван, «Видеонаблюдение

пешеходов на сигнальных перекрестках», Транспорт

Research Record, vol. 2073, стр. 11–17, 2008.

[15] Дж. Версавель, «Защита участников дорожного движения с помощью интеллектуальных камер наблюдения:

Повышение безопасности пешеходов с помощью технологии обработки видеоизображений»,

15-й Всемирный конгресс по интеллектуальным транспортным системам, 2008 г.

[16] Л. Буде и С. Мидене, «Обнаружение пешеходных переходов на основе

доказательств слияния видеодатчиков», Транспортные исследования, часть C,

vol. 17, нет. 5, pp. 484–497, 2009.

[17] К. Исмаил, Т. Сайед, Н.Сонье и К. Лим, «Автоматический анализ

конфликтов между пешеходами и транспортными средствами с использованием видеоданных», Transportation Research

Record, vol. 2140, pp. 44–54, 2009.

[18] Т. Моррис, X. Ли, В. Мореллас и Н. Папаниколопулос, «Видеообнаружение

и классификация пешеходных событий на перекрестках и пешеходных переходах»,

Tech. Rep., 2013.

[19] С. Колер, М. Голдхаммер, С. Бауэр, С. Зеха, К. Долл, У. Брунсманн,

и К. Дитмайер, «Стационарное обнаружение намерения пешехода на

.

перекрестков.”Журнал IEEE Intelligent Transportation Systems Magazine, vol. 5,

нет. 4, pp. 87–99, 2013.

[20] М. С. Ширази и Б. Моррис, «Контекстная комбинация внешнего вида и движения

для видеороликов о перекрестках с транспортными средствами и пешеходами», Лекция

Notes in Computer Science, vol. 8887, pp. 708–717, 2014.

[21] С. ´

Альварес, Д.Ф. Льорка и М.А. Сотело, «Иерархическая камера

, автоматическая калибровка для систем наблюдения за дорожным движением», Expert Systems with

Applications, т.41, pp. 1532–1542, 2014.

[22] М. Голдхаммер, Э. Стригель, Д. Мейснер, У. Брунсманн, К. Долл,

и К. Дитмайер, «Совместная мультисенсорная сеть для безопасности дорожного движения.

приложений на перекрестках »на 15-й Международной конференции IEEE по

Интеллектуальных транспортных системах, 2012 г.

[23] У. Фаворил,« ​​Обнаружение пешеходов для повышения безопасности движения и эффективности

на сигнальных перекрестках »в 8-м Международная конференция IEEE

по расширенному видеонаблюдению и видеонаблюдению, 2011 г.

[24] Д.Ф. Льорка, И. Парра, Р. Кинтеро, К. Ферн

андес, Р. Искьердо и MA

Сотело, «Обнаружение пешеходов на пешеходных переходах на основе стереозвука.

Оценка поведенческого моделирования, »В ICINCO2014, Международная конференция по информатике в управлении, автоматизации и робототехнике, Международная конференция

, 2014.

[25] Б. Фольц, Х. Меленц, Г. Агаменнони и Р. Зигварт,« Оценка актуальности характеристики

для изучение поведения пешеходов на пешеходных переходах »,

на 18-й Международной конференции IEEE по интеллектуальному транспорту

Systems, 2015.

[26] Дж. Чжоу и Дж. Ши, «Поиск алгоритмов и приложений для локализации

обзор», Journal of Intelligent Manufacturing, vol. 20, нет. 6, pp. 695–

707, 2009.

[27] Х. Лю, Х. Дараби, П. Банерджи и Дж. Лю, «Обзор беспроводных методов и систем позиционирования внутри помещений

», IEEE Transactions on Systems,

Человек и кибернетика — Часть C, т. 37, нет. 6, pp. 1067–1080, 2007.

[28] Т. Джерма, Ф. Лерасле, Н. Уада и В.Каденат, «Объединение данных Vision и rfd

для отслеживания людей в воронах с помощью мобильного робота», Computer Vision

and Image Understanding, vol. 114, pp. 641–651, 2010.

[29] Т. Ник, С. Кордес, Дж. Готце и У. Джон, «Локализация с помощью камеры

пассивных RF-этикеток», в International Conference on Indoor Positioning

and Indoor Navigation, 2012.

[30] F. Schwiegelshohn, T. Nick и J. Gotze, «Локализация на основе

слияния данных радио- и стереоизображения», в 10-м семинаре по позиционированию

Navigation и коммуникации (WPNC), 2013.

[31] Т. Мияки, Т. Ямасаки и К. Айзава, «Отслеживание людей с использованием частиц

— фильтр, объединяющий визуальную и беспроводную локализацию для широко распространенной камеры»,

на Международной конференции IEEE по обработке изображений (ICIP). )., 2007.

[32] A. de San Bernabe, JRM d. Диос и А. Оллеро, «Механизмы эффективной интеграции rssi

в локализацию и отслеживание с беспроводными сетями камер

», Международная конференция IEEE / RSJ по интеллектуальным роботам и системам

(IROS), 2013.

[33] Л. Радаэлли, Й. Моисей и К. С. Йенсен, «Использование камер для улучшения определения местоположения внутри помещений на основе Wi-Fi», Конспект лекций по информатике, вып.

8470, стр. 166–183, 2014.

[34] М. Голлер, К. Файхтенхофер и А. Пинц, «Слияние данных и компьютерного зрения для вероятностной локализации тегов», Международная конференция IEEE.

по RFID (IEEE RFID), 2014.

[35] Д.Ф. Льорка, Р. Кинтеро, И. Парра, Р. Искьердо, К. Фернндес и М.A.

Sotelo, «Вспомогательные пешеходные переходы с помощью стереолокализации

и RFID анонимной идентификации инвалидности», IEEE Intelligent Trans-

Portation Systems Conference (ITSC), 2015.

[36] AT Parameswaran, MI Husa и С. Упадхьяя, «Является ли rssi надежным параметром

в алгоритмах локализации датчиков, экспериментальным исследованием», в

Field Failure Data Analysis Workshop, 2009.

[37] К. Хёртефе и Ф. Валуа, «Is rssi хороший выбор для локализации в беспроводной сенсорной сети

? » в 26-й Международной конференции IEEE по

Advanced Information Networking and Applications (AINA), 2012.

[38] А. Исаси, С. Родригес, JLD Armentia, и А. Виллодас, «Местоположение,

отслеживание и идентификация с помощью слияния данных RF и Vision», 2010 г.

Европейский семинар по смарт-объектам: системы, технологии и

Applications (RFID Sys Tech), 2010.

[39] X. Zhao, Z. Xiao, and AM. Н. Т. Ю. Рен, «Бетл измеряет

по сравнению с Wi-Fi?» сравнение характеристик определения местоположения внутри помещений »на 20-й Европейской конференции по беспроводной связи

, 2014 г.

[40] S. ´

Альварес, М.А. Сотело, Д.Ф. Льорка, Р. Кинтеро и О. Маркос,

«Обнаружение целей на основе монокулярного зрения на динамических транспортных инфраструктурах

», конспект лекций Наука, т. 6927, pp. 576–583,

2012.

[41] I. Parra, DF Llorca, MA Sotelo, LM Bergasa, PR de Toro,

J. Nuevo, M. Ocana и MA Garc´

ıa-Garrido., «Комбинация методов извлечения функции

для обнаружения пешеходов svm», IEEE Transactions on

Intelligent Transportation Systems, vol.8, вып. 2, pp. 292–307, 2007.

[42] С. Блэкман, Р. Пополи, Проектирование и анализ современных систем слежения

. Artech House, 1999.

David Fern´

andez-Llorca получил M.S. и

со степенью доктора наук в области телекоммуникаций

от Университета Алькала

a (UAH), Мадрид, Испания,

в 2003 и 2008 годах соответственно. В настоящее время работает

доцентом по грн. Он является автором

более 90 реферируемых публикаций в

международных журналах, глав книг и материалов конференций.

Его исследовательские интересы сосредоточены на компьютерных системах видеонаблюдения и интеллектуальных транспортных системах. Д-р Ф.-

Льорка в настоящее время является помощником редактора IEEE

«Транзакции по интеллектуальным транспортным системам».

Он получил награду IEEE ITSS Outstanding Application Award 2013, награду Best

Young Researcher Award в гривне в 2013 году, премию Best PhD от

гривен в 2008 году, награду за лучшее исследование в области автомобилей

и транспортных средств. Заявки в Испании в 2008 году, награда 3M Foundation Awards в категории

в категории eSafety в 2009 году, награда MSc Thesis Award в области электронной безопасности от

ADA за лекцию в Техническом университете Мадрида в 2004 году и награду

Best Telecommunication Engineering Student Award от IVECO в 2004 году.

Ra´

ul Quintero M´

Inguez получил M.S. степень

в области компьютерных наук Университета

Алкала

a (UAH), Мадрид, Испания, в 2009 году. Он

, в настоящее время является научным сотрудником отдела компьютерной инженерии

в гривне и он работает

над своей докторской степенью в пешеходной тропе, намерении и

прогнозировании поз. Он был основным автором лучшего рабочего доклада

на IEEE ITSC2015.Его исследования в области

интересов включают обнаружение пешеходов, компьютерное зрение, интеллектуальные транспортные системы

и интеллектуальные автомобили

автомобилей.

Игнасио Парра Алонсо получил M.S. и докторская степень

в области инженерии телекоммуникаций от

Университета Алькала

a (грн.) в 2005 и 2010 годах,

соответственно. В настоящее время работает доцентом кафедры вычислительной техники

, грн.Его исследовательские интересы включают интеллектуальные транспортные системы

, интеллектуальные транспортные средства, искусственное зрение и операционные системы

. Доктор Парра Алонсо повторно получил премию за магистерскую диссертацию в области электронной безопасности от

, лекцию ADA в Техническом университете

в Мадриде, Испания, в 2006 году и премию 3M Foundation

в категории электронной безопасности в 2009 году.

Толстый револьверный инструмент iSeries ™ | Инновационная оснастка для штамповочного пресса

Линия инструментов iSeries ™ полностью совместима с системой идентификации инструментов AITS®.Все ключевые компоненты имеют лазерную маркировку с кодом матрицы данных, который содержит уникальный серийный номер для этого компонента. Система сканирует и сохраняет данные об инструментах под этим серийным номером из этого кода, что позволяет автоматизировать инвентаризацию инструментов и управлять ими.

iSeries ™ Функции:
  • Код матрицы данных, совместимый с системой AITS, с лазерной маркировкой на всех инструментах
  • Документ с характеристиками инструмента сопровождает каждую партию инструмента
  • Узлы HPX® и HP2 имеют механически закрепленную функцию удержания направляющих, которая обеспечивает фиксацию инструмента в собранном состоянии во время загрузки

Стили инструментов, доступные в iSeries ™:
  • Станция HPX® A и B
  • Метрический стиль HP2 (станции A и B)
  • Метрическая система HP (станции C, D и E)
  • Wilson HP Style (станции C, D и E)
  • HP DuraBlade® (Станция D & E)

ПРИМЕЧАНИЕ. Этот продукт можно приобрести только в офисе White Bear Lake, штат Миннесота, США.

Wilson Tool International предлагает самый широкий в отрасли набор стандартных инструментов для штамповочного пресса практически для любого применения с толстой револьверной головкой. Благодаря нашей новаторской технологии EXP® , доступной линии Basix , высокопроизводительному HP Dura Blade ® и увеличивающейся емкости Multi-Tools у нас есть решение практически для любого приложения.

Мы понимаем, что каждый магазин уникален, и наш спектр решений отражает это. Стандартная линия толстых револьверных головок позволяет создавать узлы малых и больших станций в традиционных формах и в неограниченном количестве нестандартных форм.Выберите метрическую систему или стиль Вильсона; Особенности сборки Basix, HP2 или HPX; Опции для тяжелых условий эксплуатации и многое другое.

Просмотрите многофункциональный инструмент , чтобы увеличить мощность револьверной головки, или решение для отрезки для оптимизации задач отрезки. Выберите линейку инструментов iSeries с толстой револьверной головкой для полной интеграции с системами идентификации инструмента AITS®.

Ознакомьтесь со всеми стандартными вариантами оснастки для толстой револьверной головки ниже. Чтобы ознакомиться с решениями для специальных применений или инструментов для формования, ознакомьтесь с нашим разделом Thick Turret Specials .

Быстрое обнаружение инокулята Ceratocystis platani с помощью количественного анализа ПЦР в реальном времени

Резюме

Ceratocystis platani является возбудителем язвенного поражения платанов, смертельной болезни, способной убить зрелые деревья за один или два последовательных вегетационных сезона. Возбудитель является карантинным организмом и оказывает негативное влияние на антропогенные и естественные популяции платанов. Загрязненные опилки, образующиеся во время обрезки и санитарных рубок, могут способствовать распространению болезней.Целью этого исследования было разработать быстрый количественный ПЦР-анализ в реальном времени для обнаружения инокулята C. platani , переносимого по воздуху. Ловушки для переносимого по воздуху инокулята (AIT) были размещены в городских условиях во Флоренции, Италия, где присутствовала болезнь. Праймеры и зонды TaqMan для связывания малых бороздок (MGB) были разработаны для нацеливания на гены цератоплатанина (CP) и внутреннего транскрибированного спейсера 2 (ITS2). Пределы обнаружения анализа составляли 0,05 пг / мкл и 2 фг / мкл грибковой ДНК для CP и ITS, соответственно.Обнаружение патогенов непосредственно из AIT продемонстрировало специфичность и высокую чувствительность для C. platani , обнаруживая концентрации ДНК от 1,2 × 10 –2 до 1,4 × 10 –2 пг / мкл, что соответствует ~ 10 конидий на мл. Ловушки для инокулята, переносимого по воздуху, смогли обнаружить инокулят C. platani в пределах 200 м от ближайшего зараженного платана с симптомами. Комбинация воздушно-капельной ловушки и количественного анализа ПЦР в реальном времени обеспечивает быстрый и чувствительный метод специфического обнаружения C.platani инокулят. Этот метод можно использовать для определения периода наибольшего риска распространения патогена на участке, тем самым помогая контролировать заболевание.

ВВЕДЕНИЕ

За последние 20 лет были разработаны протоколы биобезопасности для защиты растений с целью предотвращения распространения инвазивных патогенов растений и содействия их искоренению (1). Большинство инвазивных чужеродных вредителей и патогенов, которые распространяются в новую среду, заносятся в результате коммерческой торговли растениями (2, 3, 4, 5).Контроль над этими патогенами чрезвычайно затруднен, когда присутствует фаза распространения по воздуху, что позволяет болезни распространяться в более широком масштабе (6).

В местном масштабе, в том числе в городских районах, способность обнаруживать инокулят, переносимый по воздуху, имеет решающее значение для понимания распространения болезней и борьбы с патогенами, вызывающими повреждение растений, такими как Ceratocystis platani (J. M. Walter) Engelbr. & T. C. Harr. (= Ceratocystis fimbriata Ellis & Halsted f. Sp. platani Walter), возбудитель пятен от язвы платанов.Этот гриб вызывает смертельную болезнь на Platanus × acerifolia (Aiton) Willd (лондонский самолет), Platanus orientalis L. (восточный план) и в меньшей степени на Platanus occidentalis L. (платан американский). на городских плантациях, плантациях для производства древесины и волокна, а также в естественных лесах как в Северной Америке, так и в Европе (7, 8, 9, 10).

В Северной Америке C. platani причинили значительный ущерб лондонским платанам в городских районах в 1930-е годы (7) и P.occidentalis в 1960-х (8) и 1990-х годах (9).

C. platani был завезен в Европу из юго-востока США, вероятно, на древесине, связанной с военными припасами во время Второй мировой войны (10). Первое подтверждение болезни было в Тоскане, Италия, в 1972 году (11), где патоген уже разрушил монументальный проспект, соединяющий Реджиа-ди-Казерта с Неаполем (12). В Европе патоген в настоящее время присутствует в Армении, Франции, Швейцарии (13) и Греции (14), где он вызывает серьезные потери у естественных P.orientalis популяций. Из-за сильного воздействия на платаны C. platani считается карантинным организмом Европейской и Средиземноморской организацией защиты растений (ЕОКЗР) (15).

Грибок представляет собой раневой паразит, который колонизирует ткани ксилемы и убивает дерево в течение нескольких лет после заражения (16). C. platani естественным образом передается через корневой анастомоз, зараженную воду и, как предполагают результаты недавних исследований, через ассоциацию с жуками-амброзиями (14, 17).Тем не менее, наиболее важными средствами распространения, особенно в городских районах, являются загрязненные опилки и оборудование, используемое для санитарных рубок (7). В этом контексте мониторинг посевного материала может привести к лучшему пониманию динамики распространения по воздуху в окружающей среде.

В последние годы было разработано несколько методов улавливания переносимого по воздуху инокулята инвазивных лесных патогенов из проб окружающей среды. Древесные диски использовались для улавливания конидий Heterobasidion irregulare на сосновых плантациях (18, 19), а бумажные фильтры использовались для улавливания инокулята Fusarium circinatum на участках, инфицированных язвой сосновой смолы (20).Использование надежных методов улавливания в сочетании с чувствительными молекулярными подходами, такими как количественная ПЦР в реальном времени (кПЦР), позволяет быстро и точно определять грибковые патогены в этих образцах (21). Появление этого молекулярного метода позволило использовать более быстрые и чувствительные диагностические инструменты для идентификации и количественной оценки болезнетворных агентов. Точность и надежность КПЦР также может позволить обнаруживать скрытые грибковые инфекции до появления симптомов (22, 23) и обнаруживать грибковые патогены, которые трудно культивировать (21).

Целью описанной здесь работы была разработка точного и воспроизводимого метода обнаружения C. platani в пробах из окружающей среды с использованием анализа qPCR. Затем этот молекулярный подход был использован для изучения мелкомасштабной эпидемиологии этого патогена и оценки распространения инокулята во время санитарных рубок.

МАТЕРИАЛЫ И МЕТОДЫ

Изоляты грибов, выделение ДНК и филогенетический анализ.

Штаммы Ceratocystis platani , использованные в этом исследовании (), были получены из Центрального бюро по шиммелкальтурам (CBS, Нидерланды) и из коллекций Istituto per la Protezione delle Piante-Consiglio Nazionale delle Ricerche (IPP-CNR, Италия). .Изоляты грибов выращивали на целлофановых дисках 300PT (Celsa, Varese, Италия) на картофельном агаре с декстрозой (PDA; Difco Laboratories, Детройт, Мичиган) в чашках Петри диаметром 90 мм и инкубировали в темноте при 20 ° C. Через 7 дней мицелий соскребали с поверхности целлофана и хранили в 1,5-мл микроцентрифужных пробирках (Sarstedt, Верона, Италия) при -20 ° C. Экстракцию ДНК проводили из мицелия с использованием прибора E.Z.N.A. мини-набор ДНК растений (Omega Bio-tek, Norcross, GA) в соответствии с инструкциями производителя.Концентрацию экстрагированной ДНК измеряли с помощью спектрофотометра Nanodrop ND-1000 (NanoDrop Technologies, Wilmington, DE). Для выяснения филогенетических отношений между C. platani и другими видами Ceratocystis () и для проверки специфичности анализа qPCR, выравнивание последовательностей внутреннего транскрибируемого спейсера (ITS), β-тубулина и цератоплатанина. (CP) гены. Цератоплатанин — небольшой гидрофобный белок из C. platani (24).Область ITS2 амплифицировали с помощью общих праймеров ITS1 и ITS4 согласно White et al. (25), тогда как ген β-тубулина амплифицировали с использованием праймеров Bt2a и Bt2b, как описано Glass и Donaldson (26). Цератоплатанин амплифицировали с набором праймеров CeraF (5′-ATGAAGTTCTCTATCCTACCC-3 ‘) и CeraR (5′-AGGAGCTTCCGGAGAAGTCAC-3’) (это исследование) со следующими условиями цикла: начальная денатурация 95 ° C в течение 2 минут, затем на 40 циклов при 94 ° C в течение 30 с, 55 ° C в течение 45 секунд и 72 ° C в течение 90 секунд с заключительной стадией удлинения при 72 ° C в течение 9 минут.Продукты ПЦР очищали и секвенировали непосредственно с использованием набора для готовых реакций секвенирования цикла терминатора BigDye197 (Applied Biosystems, Foster City, CA) и анализировали с помощью 48-капиллярного секвенатора ДНК ABI-3130xl (Applied Biosystems). Филогенетические деревья максимального правдоподобия (ML) были построены для ITS и для конкатенированных последовательностей β-тубулина и CP с использованием программы RAxML (27) с моделью GTR (28, 29). Значения начальной загрузки оценивались на основе 1000 повторов. Расчеты проводились в Витал-ИТ Центре (http: // www.vital-it.ch) для высокопроизводительных вычислений Швейцарского института биоинформатики (SIB). Petrellia setifera ({«type»: «entrez-nucleotide», «attrs»: {«text»: «AF043596», «term_id»: «2865497», «term_text»: «AF043596»}} AF043596) от Witthuhn и другие. (30) использовалась как внешняя группа для ITS-дерева, а Ceratocystis albifundus ({«type»: «entrez-nucleotide», «attrs»: {«text»: «EU244986», «term_id»: «167380363» , «term_text»: «EU244986»}} EU244986) от Heath et al. (31) использовалась как внешняя группа для конкатенированного дерева.

Таблица 1

Изоляты грибов, использованные в этом исследовании

CaoCao CACAO fimbriata 9089 Populus tremuloides 900BS 9089 C.platani А.alternata Италия S.
Виды грибов Идентификационный номер штамма. Хост Происхождение Источник a
Ceratocystis
Эквадор CBS
C.fimbriata CBS115166 Ficus carica Бразилия CBS
C. fimbriata CBS14653 C. CBS115167 Syngonium Флорида CBS
C. fimbriata CBS115173 9006 Gmelina CBS115173 9089 Gmelina arborea

90 9035fimbriata
CBS118126 Syzygium aromaticum Sulawesi CBS
C. fimbriata CBS114723 a bat9

CBS
CBS115175 Mangifera indica Бразилия CBS
C. fimbriata CBS115174

Бразилия CBS115174
9018
CBS115171 Colocasia esculenta Бразилия CBS
C. fimbriata CBS74040 900cea junior 9036 CBS74040 900cea

C.
CBS114717 Prunus dulcis CA CBS
C. populicola CBS115161 Populus tremuloides 8 CBS115162 Platanus occidentalis NC CBS
C. platani CBS117355 Platanus sp. Франция CBS
C. variospora CBS114714 Quercus robur Rhodes CBS
C. Греция NAGREF
C. platani CF0 P . × acerifolia Италия IPP-CNR
C. platani Cp3 P . × acerifolia Италия IPP-CNR
C. platani Cp5 P . × acerifolia Италия IPP-CNR
C.Платани CP6 P . × acerifolia Италия IPP-CNR
C. platani Cp8 P . × acerifolia Италия IPP-CNR
C. platani Cp9 P . × acerifolia Италия IPP-CNR
Другие виды
Alternaria alternata 1259 A1 F. ornus Италия IPP-CNR
Cladosporium sp. C4 / 2 F. ornus Италия IPP-CNR
Epicoccum niger C8 / 3 6 F. ornus
E. niger C4 / 3 F.орнус Италия IPP-CNR
Microsphaera platani M1 P . × acerifolia Италия IPP-CNR
M. platani M2 P . × acerifolia Италия IPP-CNR
Sarchodontia pachyodon Sp9 Quercus ilex Италия IPP-CNR 909пахиодон Sp5 P . × acerifolia Италия IPP-CNR
S. pachyodon Sp3 Quercus ilex Италия IPP-CNR IPP-CNR П . × acerifolia Италия IPP-CNR

Условия анализа qPCR.

25 мкл смеси для ПЦР, содержащей 12,5 мкл мастер-микса TaqMan Universal (Applied Biosystems), проводили на детекторе последовательностей ABI Prism 7300 (Applied Biosystems). Конечные концентрации праймера и зонда были следующими: прямой праймер 300 нМ (Eurofins MWG Operon, Ebersberg, Германия), 300 нМ обратный праймер (Eurofins MWG Operon) и зонд TaqMan MGB 200 нМ (Applied Biosystems), предназначенный для амплификации ITS. и гены CP. Для каждой пробирки использовали 5 мкл образца ДНК.

Все образцы ДНК анализировали в оптических 96-луночных планшетах MicroAmp (Applied Biosystems), закрытых оптическими колпачками MicroAmp, с использованием детектора последовательности ABI Prism 7300 (Applied Biosystems).Каждый образец ДНК анализировали в трех повторностях. Четыре лунки, каждая из которых содержала 5 мкл стерильной воды, использовали в качестве контроля без матрицы (NTC). Протокол ПЦР: 50 ° C (2 мин), 95 ° C (10 мин), 50 циклов при 95 ° C (30 с) и 60 ° C (1 мин).

Результаты были проанализированы с использованием системы обнаружения последовательности SDS 1.9 (Applied Biosystems) после ручной корректировки исходного уровня и порога флуоресценции. Измерения ДНК C. platani в неизвестных образцах были выполнены путем интерполяции стандартной кривой, построенной с помощью C.platani , который амплифицировали в том же цикле ПЦР. Стандартная кривая была построена из 5-кратных серийных разведений (в диапазоне от 100 нг / пробирка до 0,25 пг / пробирка) известной концентрации C. platani ДНК (штамм Cp5) и проанализирована в трех повторностях в семи независимых анализах. Количество ДНК C. platani выражали в пг / мкл.

МТА.

Эффективность системы улавливания инокулята в воздухе (AIT) оценивалась путем инокуляции фильтровальной бумаги Whatman конидиальной суспензией C.platani с последующим молекулярным обнаружением. AIT были приготовлены с использованием чашек Петри диаметром 90 мм (Sarstedt, Верона, Италия), содержащих ватман No. 1 фильтровальная бумага (Sigma-Aldrich, Милан, Италия), смоченная 4 × TE буфером (40 мМ Tris HCl, 4 мМ EDTA [pH 8,0]) (20). Каждую чашку Петри прикрепляли к основанию небольшого алюминиевого лотка (500 мл) с помощью двусторонней липкой ленты. Поднос закрывали пластиковой сеткой (размер ячеек 6 на 6 мм). Суспензию конидий (1 мл в стерильной воде) получали при температуре ° С.platani изолят CF0 () после инкубации на 1,5% PDA в течение 10 дней. Количество конидий определяли в камере Беркера и готовили пять серийных разведений 1:10 в диапазоне от 10 до 10 5 конидий / мл. Для каждого конидиального разведения осадок получали после центрифугирования при 16100 × g в течение 5 мин и использовали для экстракции ДНК. Два ватмана нет. 1 фильтровальную бумагу засевали каждым из разведений конидий. Затем фильтры промывали в центрифужной пробирке на 50 мл (Sarstedt), содержащей 20 мл буфера ТЕ (4 ×) при 65 ° C.Каждую пробирку центрифугировали при 289 × g в течение 90 мин для осаждения осадка. Затем один миллилитр суспензии, содержащей осадок и TE-буфер, переносили в 2-миллилитровую микроцентрифужную пробирку (Sarstedt) и после центрифугирования при 16100 × g в течение 5 минут осадок использовали для экстракции ДНК с использованием E.Z.N.A. набор ДНК растений, как описано ранее. Как ДНК из конидиальной суспензии, так и инокулированная фильтровальная бумага тестировали с помощью КПЦР, как описано выше.

C. platani , экологическое обследование.

Экологическое исследование было проведено в октябре 2011 года на уличных платанах во Флоренции, Италия (43 ° 47′59 ″ с.ш., 11 ° 13′94 ″ в.д., 51 м над уровнем моря) для оценки наличия C Инокулят platani в городских условиях с использованием АИТ. Присутствие патогена определяли в двух областях отбора проб: (i) зараженная область с Platanus × acerifolia , показывающая симптомы пятен язвы, и (ii) окружающая область со здоровыми платанами.Отбор проб производился на участках не менее 50 м друг от друга. В зоне заражения была запланирована санитарная вырубка для удаления зараженных платанов. Присутствие C. platani в зоне инфекции на симптоматических плоскостях было подтверждено выделением на КПК (33). Вкратце, выделения проводились из образцов, взятых на границе между некротическими и здоровыми тканями. Небольшие фрагменты собирали с края некротизированной ткани и помещали в чашки Петри диаметром 90 мм на 1.5% КПК и инкубировали при 20 ° C в течение 10 дней. Кроме того, ДНК экстрагировали как из некротических, так и из здоровых тканей и анализировали с помощью КПЦР, как описано выше. Всего было изготовлено 25 АИТ: 11 размещены на зараженном участке, а остальные 14 размещены на прилегающей территории. Каждый АИТ размещался на высоте 2 м над уровнем почвы на расстоянии 10 м друг от друга на каждом фонаре. В окрестностях за 7 дней до санитарных рубок устанавливали ловушки и ежедневно смачивали 5 мл 4-кратного TE-буфера (pH 8.0) на фильтр. Чтобы избежать заражения ловушек C. platani перед началом рубок, ловушки были помещены в очаг заражения ранним утром и сняты в тот же день после завершения рубок. AIT были доставлены в лабораторию, ДНК была извлечена из фильтров, как описано выше, и была проведена количественная ПЦР для определения присутствия C. platani .

Тесты на патогенность.

Для оценки минимального количества C. platani , способного вызвать повреждение платанов, были проведены испытания инокуляции на 18 5-летних горшечных рамах Platanus × acerifolia , полученных путем укоренения черенков отдельного самолета. дерево.(Раметы — это вегетативно воспроизводимые копии растения; каждый рамет имеет тот же генотип, что и исходное родительское дерево.) Инокуляцию проводили в мае 2012 года путем ранения на 40 см над почвой (диаметр стебля 1 см), по одной ранке на каждое растение. , используя лезвие ножа с каплей 0,2 мл пяти последовательных разведений 1:10, ранее использовавшихся для прививок AIT (конидиальные концентрации в диапазоне от 10 до 10 5 конидий / мл). Были инокулированы три крысы для каждой конидиальной концентрации, и три раненых неинокулированных крыла использовали в качестве контрольных растений.Раметы были завернуты в парафильм в местах посева для уменьшения загрязнения и предотвращения чрезмерного высыхания. Через 4 месяца было обнаружено C. platani по наличию специфических симптомов и повторному выделению мицелия из инокулированной плоской ткани на КПК (33).

Анализ данных.

Эффективность ПЦР рассчитывалась по наклону стандартной кривой: эффективность = 10 (-1 / наклон) -1 (34). Воспроизводимость анализа кПЦР оценивали путем вычисления коэффициента вариации (% CV) среди средних значений в семи независимых анализах.Пороговое значение составляло 0,15, и исходная эмиссия была рассчитана для циклов с 3 по 15. Точность AIT в перехвате воздушного инокулята C. platani при различных конидиальных концентрациях была проверена путем количественного определения области ITS с помощью qPCR с ДНК экстрагировали из большой серии разведений грибковых конидий, полученных либо из засеянной фильтровальной бумаги Whatman, либо непосредственно из дистиллированной воды. Экспоненциальная функция log-log в форме y = a + be x была приспособлена к данным для описания взаимосвязи между конидиальным разведением ( x ) и количеством грибковой ДНК ( y ) в обоих типах выборок, и сравнивались оценки параметров.Сравнение моделей включало проверку гипотезы о том, что оба набора данных (экстракция из конидий в воде или из конидий на фильтровальной бумаге Whatman) имеют одну и ту же кривую. Оценки параметров, полученные путем раздельного применения модели к двум наборам данных, были протестированы (тест F ) по сравнению с оценками, полученными путем глобального подбора одной и той же модели к обоим наборам данных. Факторный дисперсионный анализ (ANOVA) (взаимодействие типа субстрата × конидиальная концентрация) применяли для дальнейшего тестирования различий между двумя методами.Логит-модель (обобщенная линейная модель [GLZ]) применялась для проверки диффузии инокулята (как его наличия, так и количества) в зависимости от расстояния от ближайшего симптоматического дерева и количества симптоматических деревьев в окрестностях ловушки. Взаимосвязь между присутствием или отсутствием или количеством инокулята в AIT и расстоянием от симптоматических деревьев описывалась путем подбора обратной экспоненциальной модели, показанной уравнением ( y = a + be x ) к этим данным.GLZ-анализ, нелинейная оценка (процедура аппроксимации кривой наименьших квадратов, алгоритм Левенберга-Марквардта) и ANOVA выполнялись в Statistica 6.0 (35).

Номера доступа нуклеотидных последовательностей.

Вновь определенные последовательности (для последовательностей ДНК ITS1-5.8S-ITS2, CP и β-тубулина) депонированы в GenBank под номерами доступа {«type»: «entrez-нуклеотид», «attrs»: {«text» : «KC493159», «term_id»: «510794567», «term_text»: «KC493159»}} KC493159 на {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KC493171», «term_id» «:» 510794579 «,» term_text «:» KC493171 «}} KC493171, {» type «:» entrez-нуклеотид «,» attrs «: {» text «:» KF302676 «,» term_id «:» 523408207 «,» term_text «:» KF302676 «}} KF302676 в {» type «:» entrez-нуклеотид «,» attrs «: {» text «:» KF302687 «,» term_id «:» 523408229 «,» term_text «:» KF302687 «} } KF302687 и {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KF302688», «term_id»: «523408175», «term_text»: «KF302688»}} KF302688 для {«type «:» entrez-nucleotide «,» attrs «: {» text «:» KF302703 «,» term_id «:» 523408205 «,» term_text «:» KF302703 «}} KF302703 (подробнее см. Таблицу S1 в дополнительном материал).

РЕЗУЛЬТАТЫ

Филогенетический анализ изолятов

Ceratocystis .

Филогенетическая топология, реконструированная с помощью ITS-последовательностей и конкатенированных последовательностей β-тубулина и CP, показала, что C. platani встречается в основном кластере изолятов C. fimbriata (см. Рис. S2 и S3 в дополнительном материале). . Классификация Ceratocystis cacaofunesta в одном кластере подтвердила тесную филогенетическую связь между этими штаммами.Напротив, C. variospora и C. populicola дифференцировались в отдельную кладу (см. Рис. S2 и S3).

Зонды TaqMan MGB и специфичность праймеров.

Для каждого гена-мишени (ITS и CP) положения вышестоящего праймера, обратного праймера и внутреннего зонда показаны в. Общая длина ампликонов составляла 55 п.н. и 59 п.н. для генов-мишеней ITS и CP соответственно. Характеристики праймеров и зонда приведены в. Нуклеотид-нуклеотидный поиск BLAST показал полную гомологию (100%) между последовательностью CP-ампликона, разработанной как для C.platani гены-мишени (CP и ITS). Только изолятов C. platani были положительно амплифицированы с помощью кПЦР на ДНК грибов с использованием обеих комбинаций праймер-зонд, разработанных для мультикопийных (ITS) и однокопийных (CP) генов. ДНК из изолятов других видов Ceratocystis и грибов других родов не амплифицировались ().

Выравнивание двух праймеров и последовательностей зонда TaqMan MGB против внутреннего транскрибируемого спейсера (ITS) и гена цератоплатанина (CP), для которых был разработан анализ.Последовательности праймеров указаны прямоугольниками со стрелками, а последовательности зондов показаны заштрихованными прямоугольниками. Эталонные последовательности Ceratocystis platani были {«type»: «entrez-нуклеотид», «attrs»: {«text»: «EU426554», «term_id»: «183013710», «term_text»: «EU426554»}} EU426554. для ITS и {«type»: «entrez-нуклеотид», «attrs»: {«text»: «EF017218», «term_id»: «121624689», «term_text»: «EF017218»}} EF017218 для CP. Последовательности C. cacaofunesta (CBS15362), C. fimbriata (114723), C.populicola (115161) и C. variospora (114719).

Таблица 2

Праймеры и зонды, разработанные для Ceratocystis platani с использованием программного обеспечения Primer Express 3.0

906GAT9 GTC6 909 36
Праймер / датчик TaqMan MGB Целевой ген Последовательность (5 ‘→ 3’) Положение (5 ‘→ 3’) Положение a Размер ампликона (п. –233
CP-Pr FAM-CTACACTGGGTGAAGTC-MGB 212–228
CpITS-F
CpITS-F ITSAGT 9018 ITSAGT
CpITS-R CCTCCAACGCCAAGAACAAA 354–335
CpITS-Pr FAM-CACCACTCAAGGACTC-MGB 318–333

Таблица 3

Анализы ПЦР в реальном времени для обнаружения Ceratocystis platani из ткани мицелия, AITatan и из мицелия, AITatan и гены-мишени CP

9

%) положительных образцов

Плоская ткань
Тип образца (общ.) a Результат для датчика MGB для:
ITS-ген b
CP-ген c C T ± SD Количество (%) положительных образцов C T ± SD
Мицелий
Ceratocystis platani (9) 9 (100) 15.75 ± 0,75 9 (100) 14,25 ± 0,46
C. cacaofunesta (1), C. fimbriata (11), C. populicola (1), C. variospora (1), Alternaria alternata (2), Cladosporium sp. (1), Epicoccum niger (2), Microsphaera platani (2), Sarchodontia pachyodon (4) 0 (0) > 40 0 (0) > 40
АИТ
Зараженная зона (10) 9 (90) 34.89 ± 3,01 3 (30) 37,82 ± 1,30
Окружающая область (14) 4 (28,5) 36,74 ± 1,37 0 (0) > 40
Зараженные (10) 10 (100) 26,45 ± 0,93 10 (100) 26,59 ± 0.80
0) > 40 0 (0) > 40

Воспроизводимость и чувствительность анализа кПЦР.

Качество стандартных кривых оценивали путем сравнения пороговых значений цикла ( C T ) для каждой точки кривой, поскольку каждое значение гипотетически должно быть одинаковым в повторных пробах, прогоняемых в одинаковых условиях. Наблюдались различия между стандартными кривыми, построенными с использованием генов CP и ITS (,). Однако воспроизводимость стандартных кривых была высокой, поскольку коэффициент вариации для каждой точки был ниже 5% для обоих генов-мишеней C. platani ().Для каждого гена-мишени измерения линейности, такие как наклон, пересечение и и коэффициент корреляции ( r 2 ), существенно не различались между семью анализами (% CV <2%). Сравнение двух комбинаций праймер-зонд CP и ITS показало различия в чувствительности: значения C T молекулярных маркеров, разработанных для гена CP, были выше, чем значения, полученные для генов ITS (). Разница (Δ C T ) между этими двумя генами-мишенями составила 6.22 ± 0,2 (среднее ± стандартное отклонение [SD]). Пределы обнаружения анализа кПЦР составляли 0,05 пг / мкл и 2 фг / мкл ДНК для комбинаций праймер-зонд CP и ITS, соответственно. Из-за более высокой чувствительности наборы комбинаций праймер-зонд ITS были впоследствии использованы для обнаружения и количественного определения C. platani из проб окружающей среды AIT.

Таблица 4

Воспроизводимость стандартных кривых ITS и CP

9036 87 ± 0,25 6 909 SD 2 )
Параметр Результат стандартной кривой для a :
ITS
4 Серийное разведение (пг / пробирка) ( n = 24)
C T ± SD % CV C T ± SD % CV
2 × 10 4 14.22 ± 0,05 0,39 18,12 ± 0,38 2,12
4 × 10 3 15,29 ± 0,13 0,85 20,16 ± 0,67 3,33
0,39 22,72 ± 0,71 2,85
160 19,45 ± 0,19 0,96 25,02 ± 0,71 2,85
32 1,15 27,31 ± 0,80 2,94
6,4 24,60 ± 0,23 0,95 29,70 ± 0,89 3,00
9 1,0 32,25 ± 0,96 2,98
0,25 29,50 ± 0,56 1,90 35,05 ± 1,08 3,09
Прочие параметры ( n% = 7) Среднее ± SD % CV
Наклон 3.22 ± 0,01 0,39 3,30 ± 0,03 0,94
y -перехват 27,01 ± 0,06 0,21 32,23 ± 0,62 1,91
0,987 ± 0,005 0,55 0,993 ± 0,01 0,59
Эффективность 1,03 ± 0,01 0,55 1,02 ± 0,00 30

Графики амплификации ДНК Ceratocystis platani , демонстрирующие сравнение двух различных зондов TaqMan MGB. Флуоресценция (нормализованный репортерный сигнал, Rn) зондов TaqMan MGB для целевого гена CP (пунктирная линия) появляется позже, чем флуоресценция зонда, предназначенного для области ITS (сплошные линии). Для каждого гена-мишени проводили семь различных серийных разведений 1: 5 (в диапазоне от 100 нг до 0,25 пг / пробирку) ДНК Cp5 штамма C. platani .На вставке показаны стандартные кривые для абсолютного количественного определения C. platani с использованием зондов TaqMan MGB, разработанных на основе (i) гена CP (пунктирная линия) и (ii) области ITS (непрерывная линия). Стандартные кривые были построены путем нанесения чисел порогового цикла ( C T ) в зависимости от логарифмической концентрации геномной ДНК для каждой серии разведений.

Обнаружение

C. platani в пробах окружающей среды.

Изоляты C. platani (Cp3, Cp5, Cp6, Cp8 и Cp9) (), полученные из симптоматических плоских деревьев, были идентифицированы на основе морфологических характеристик и с помощью количественной ПЦР, протестированной на ДНК, выделенной из мицелия.

КПЦР также использовался для идентификации и количественной оценки C. platani в ДНК, выделенной из тканей симптоматической плоскости (). Количество C. platani ДНК, обнаруженное в этих образцах с использованием как праймера, так и зондов (наборы для CP и ITS), находилось в диапазоне от 2,0 × 10 3 до 5,0 × 10 3 пг ДНК на мкг общей экстрагированной ДНК. C. platani ДНК отсутствовала в бессимптомных тканях плоскости, используемых в качестве отрицательного контроля (). Отобранные графики амплификации ПЦР, полученные из тестируемых образцов, показаны на.

Обнаружение Ceratocystis platani зондом TaqMan MGB на ITS2. Выбор графиков амплификации из различных образцов ДНК: (i) мицелий C. platani и инфицированные плоские ткани (непрерывные линии), (ii) ловушки для инокулята, переносимые по воздуху (AIT) из области отбора образцов (пунктирные линии с точками), и C. platani конидиальная подвеска (пунктирные линии с длинными сегментами). Флуоресцентный сигнал (нормализованный репортерный сигнал, Rn) отсутствовал в контроле без матрицы (NTC), у других видов Ceratocystis и других грибов, а также в ткани здоровой плоскости (горизонтальная пунктирная линия).

При использовании комбинации праймер-зонд ITS количество C. platani ДНК, присутствующей в конидиальных суспензиях, составляло от 0,5 × 10 -2 до 1,8 × 10 2 пг / мкл общей ДНК (от ~ 10 до 10 5 конидий / мл соответственно). Обнаружение патогена из AIT различается в зависимости от используемого молекулярного маркера. Когда использовалась комбинация ITS-праймер-зонд, все 11 AIT из места заражения включали C. platani , тогда как 4 из 14 были положительными в окружающей области.Количество грибковой ДНК на этих AIT составляло от 1,2 × 10 -2 до 5,3 пг / мкл. Напротив, комбинация CP-праймер-зонд дала положительные результаты только для 3 из 11 AIT из инфицированного сайта, в то время как ловушки, расположенные из окружающей области, были отрицательными. Количество ДНК C. platani находилось в диапазоне от 4,5 × 10 -2 до 1,1 пг / мкл.

За исключением самой высокой концентрации конидий C. platani , количество полученной ДНК не варьировалось между субстратами экстракции, т.е.е., конидиальные суспензии в воде или суспензии, нанесенные на фильтровальную бумагу (ANOVA, значительное взаимодействие субстрат × концентрация, P <0,001; действительно значимая разница [HSD] post hoc test, P > 0,1). При 10 5 конидий на мл значительно большее количество ДНК было получено из суспензии конидий в воде (тест HSD post hoc , P <0,001), чем из AIT. Взаимосвязь между конидиальным разведением ( x ) и количеством C.platani ДНК, обнаруженная с помощью кПЦР с использованием комбинации праймер-зонд ITS ( y ), давала экспоненциальную кривую (как показано в уравнении: y = a + будет x ). Кривые, полученные при подгонке модели к количеству ДНК, полученной из засеянной фильтровальной бумаги ( y = -3,97 + 0,078 e x ) и из конидиальных суспензий в воде ( y = -4,22 + 0,093 e x ) были похожи ().Оценки для a и b в уравнении y = a + be x имели перекрывающиеся доверительные интервалы (, вставка) и существенно не различались между двумя кривыми ( a F Значение = 0,41; P = 0,532; b Значение F = 4,21, P = 0,063).

Обнаружение Ceratocystis platani в ватмане № 1 фильтровальная бумага, искусственно инокулированная конидиальными суспензиями.Количество C. platani ДНК, обнаруженное с помощью ПЦР в реальном времени для ITS-области, было связано с конидиальным разведением. Нелинейная регрессия ( y = a + be x ) была подогнана к данным, преобразованным в натуральный логарифм (ln), где x = ln (конидиальное разведение) и y = ln. (общая ДНК), выделенная из конидий. Результаты, полученные для конидиальных суспензий, нанесенных на фильтровальную бумагу Whatman (светлые символы и пунктирная линия; y = -3.97 + 0,078 e x ) или из конидиальных суспензий в дистиллированной воде (закрашенные символы и сплошная линия; y = -4,22 + 0,093 e x ). На вкладках приведены оценки значений параметров ( a и b ) ± 95% доверительный интервал.

C. platani был обнаружен в АИТ в пределах 200 м от ближайшего дерева симптомов. По сравнению с отрицательными AIT, положительные AIT были окружены большим количеством симптоматических деревьев в радиусе 100 м и были значительно ближе к зараженным деревьям.Частота положительных АИТ ( F S ) значительно увеличивалась с увеличением количества симптоматических деревьев ( N ST ), расположенных в радиусе 100 м (), и снижалась с увеличением расстояния ( D ) от ближайшее симптоматическое дерево (). Логит-регрессия показала, что как N ST 2 (1) = 8,26, P = 0,004], так и D 2 (1) = 10,33, P = 0.001] оказали значительное влияние на обнаружение грибка на AIT. Зависимость успешного обнаружения от D описывалась обратной экспоненциальной функцией в виде F S = a + e bD () ( a = 1,002, b = 0,008 , P ≤ 0,05; объясненная дисперсия = 81,6%). Подобная кривая эффективно описывает уменьшение количества ДНК ( Q ДНК ) C.platani , полученный из AIT, когда расстояние между ловушкой и ближайшим симптоматическим деревом увеличилось () ( Q ДНК = a + e bD ; a = 4.612, b = 0,016, P ≤ 0,05; объясненная дисперсия = 95,3%).

Распространение по воздуху инокулята Ceratocystis platani во время санитарных рубок. Показаны вариации (A) количества симптоматических деревьев в пределах 100-метрового расстояния и (B) расстояния от ближайшего симптоматического дерева в отрицательных или положительных ловушках для переносимого по воздуху инокулята (AIT) для обнаружения C.platani . Горизонтальная линия в каждом поле — среднее значение; прямоугольник представляет стандартную ошибку, а усы указывает стандартное отклонение. Открытые кружки и звездочки указывают выбросы и крайности соответственно. (C и D) Снижение частоты перехвата патогенов на AIT (успешное обнаружение) (C) и уменьшение количества ДНК C. platani (D) как обратные экспоненциальные функции расстояния до ближайшего дерева симптомов.

Тесты на патогенность.

Через 4 месяца все рамы, зараженные конидиальной концентрацией от 10 2 до 10 5 конидий / мл, погибли. Эти растения демонстрировали типичные симптомы язвы с синими пятнами, состоящую из язв на стеблях вокруг места заражения и обесцвечивания древесины. Выделение на среде PDA показало присутствие грибкового мицелия, идентифицированного как C. platani . Никаких симптомов не наблюдалось, и невозможно было успешно выделить патоген из контрольных растений и из растений, инокулированных 10 конидиями / мл.

ОБСУЖДЕНИЕ

Представленная здесь работа продемонстрировала использование чувствительного и надежного метода для обнаружения и количественной оценки переносимого по воздуху инокулята C. platani , участвующего в распространении патогенов. Этот метод сочетает в себе простой и экономичный метод улавливания с молекулярным подходом, основанным на анализе количественной ПЦР.

Применение метода количественной ПЦР в сочетании с эффективными методами улавливания инокулята позволило идентифицировать и количественно определить патоген с воздуха. Извлечение ДНК непосредственно из фильтров устраняет необходимость в трудоемкой микроскопии и культивировании и позволяет напрямую обнаруживать целевые микроорганизмы.Интеграция методов отбора проб из воздуха и молекулярной диагностики позволила получить чувствительные, специфические и количественные данные для нескольких патогенов (21). Использование КПЦР для молекулярной диагностики привлекательно из-за высокой чувствительности и пропускной способности (36, 37). Более того, этот подход позволяет обнаруживать и количественно определять очень небольшие количества грибковой ДНК и, следовательно, является мощным инструментом для раннего наблюдения и обнаружения грибковых патогенов в здоровой растительной ткани до проявления симптомов у хозяина (22, 23).

Большинство сообщений об обнаружении переносимых по воздуху микроорганизмов методом количественной ПЦР поступают из клинической микробиологии (21). Однако количественная ПЦР также использовалась для количественного определения переносимого по воздуху инокулята грибковых патогенов, таких как Sclerotinia sclerotiorum , Leptosphaeria spp., Puccinia striiformis и Botrytis squamosa (38, 39, 40, 41), которые вызывают серьезные заболевания пахотных культур, а также возбудителя лесных деревьев Fusarium circinatum (20, 42).

Многие грибковые заболевания инициируются переносимым по воздуху инокулятом, который попадает на восприимчивых хозяев при благоприятных условиях окружающей среды. Ceratocystis platani представляет значительную угрозу, особенно в городских районах, поскольку он может заразить здоровые платаны, когда во время санитарной обрезки и рубок инокулят может быть перенесен ветром на свежие раны, которые иногда присутствуют на окружающих деревьях (16). По этой причине, среди прочего, обнаружение инокулята C. platani важно для улучшения понимания механизмов и динамики распространения патогенов.

В этом исследовании набор комбинаций праймер-зонд CP и ITS может точно определить C.platani из культивируемых изолятов и не показали перекрестной реактивности с другими филогенетически родственными видами Ceratocystis . Молекулярные маркеры, разработанные здесь, были специфичными и не амплифицировали ДНК обычных переносимых по воздуху грибов, таких как Alternaria sp., Cladosporium sp. Или Epicoccum (43), которые встречаются в городских районах и у других видов. платанами, такими как Microsphaera platani (44) и Sarchodontia pachyodon (45).Для сбора переносимых по воздуху спор использовалось несколько методов, но идентификация различных видов грибов обычно основывалась на использовании традиционных методов, таких как микроскопия или культивирование на искусственных средах (21). Эти методы занимают много времени и требуют высокого уровня знаний для точной идентификации организмов, особенно если разные виды грибов имеют схожую морфологию спор. Кроме того, для C. platani переносимый по воздуху инокулят также представлен инфицированными опилками и древесными остатками, которые распространяются в окружающей среде во время санитарных операций (7).

Системы обнаружения, доступные для кПЦР, также могут быть неспецифическими, если интеркалирующие красители (например, краситель SYBR green I) создают флуоресцентное связывание с фрагментами ПЦР (46). В этой работе анализ qPCR был основан на зондах TaqMan для связывания малых бороздок (MGB), которые включают 5′-репортерный краситель и 3′-нефлуоресцентный тушитель (NFQ). NFQ предлагает преимущество более низкого фонового сигнала, что приводит к большей точности количественного определения, стабилизации гибридизации зонда с одноцепочечными ДНК-мишенями и приводит к улучшенной специфичности по сравнению с обычными зондами TaqMan (47).

Однако наблюдались разные результаты с точки зрения чувствительности при использовании разных маркерных генов, созданных на основе областей CP или ITS. Хотя оба набора праймер-зонд были специфичными для C. platani , наблюдались различия в чувствительности к патогенам. Наши результаты соответствуют результатам, полученным для Aspergillus fumigatus , где было обнаружено ~ 5-кратное различие в C T между геном FKS1, используемым в качестве однокопийного контрольного гена, против мультикопийного гена рРНК 18S. (48).Сравнимые различия (6-кратные) были также обнаружены с F. circinatum в сравнении между многокопийным рибосомным геном IGS и однокопийными генами типа спаривания (20). Эти результаты подчеркивают преимущество использования мультикопийного гена рибосомальной ДНК (рДНК), поскольку амплификация целевого гена может быть в 10-100 раз более чувствительной, чем амплификация однокопийных генов (49, 50).

Хотя однокопийный ген CP представляет собой конкретную мишень для C. platani , чувствительность разработанной здесь комбинации праймер-зонд была очень низкой, и ее использование для обнаружения грибка в образцах окружающей среды может привести к недооценке количества переносимых по воздуху посевной материал.

Наблюдаемые нами различия между генами с одной и несколькими копиями отражают различия в пределах обнаружения анализа кПЦР, который обнаружил 0,05 пг и 2 фг C. platani ДНК / мкл для CP и ITS, соответственно. Эти значения намного ниже, чем для F. circinatum , найденные Schweigkofler et al. (20), которые использовали анализ qPCR на основе химии SYBR green. Причины этих различий неизвестны. Хотя экстракция ДНК проводилась из фильтровальной бумаги Whatman, различия в количественном определении ДНК можно объяснить несколькими другими факторами — например, методами экстракции ДНК, а также менее чувствительной химией КПЦР (SYBR зеленый по сравнению с TaqMan) (46).

В настоящее время идентификация C. platani в основном основана на визуальном осмотре симптомов с последующим выделением в лаборатории среды для подтверждения (15). Метод ловушки был описан ранее для изоляции C. platani из почвы и зараженной древесины (51). Серологический анализ также был оптимизирован для подтверждения присутствия белка CP из аскоспор и мицелия C. platani (52), но он никогда не использовался в диагностических целях.Ранее сообщалось о молекулярном подходе, основанном на кПЦР, для обнаружения C. platani из искусственно и естественно зараженной древесины платана (53). Однако метод количественной ПЦР, описанный в этом исследовании, более чувствителен. Предел обнаружения описанного здесь анализа, 2 фг ДНК C. platani / мкл, был ниже, чем тот, который сообщается Pilotti et al., 10 фг / мкл (53).

Анализ qPCR, протестированный в настоящей статье, был успешно использован для обнаружения C. platani непосредственно из естественно инфицированных тканей плоскости, что делает его полезным инструментом для диагностики окрашивания плоскости рака.Однако в отличие от Pilotti et al. (53), основная цель этого исследования заключалась в оптимизации анализа количественной ПЦР, способного обнаруживать и количественно определять даже небольшие количества переносимой по воздуху ДНК C. platani . По этой причине были разработаны более короткие зонды, такие как зонд TaqMan MGB, обеспечивающий повышенную чувствительность и специфичность по сравнению с обычным зондом TaqMan (47) и обеспечивающий более эффективное обнаружение грибков.

В этой работе метод, использованный для перехвата инокулята, был аналогичен описанному Schweigkofler et al.(20). В этом исследовании самый низкий надежный предел обнаружения для конидиальных суспензий составлял ~ 10 конидий / мл (0,5 × 10 -2 пг C. platani ДНК / мкл), в то время как максимальное протестированное количество составляло 10 5 конидий / мл. (180 пг C. platani ДНК / мкл). Следовательно, минимальное количество, обнаруженное в этом исследовании, было намного ниже, чем указано Schweigkofler et al. (20), которые смогли обнаружить минимум 10 2 конидий на 100 мкл (т.е. 10 3 конидий на мл).Перехват и количественное определение инокулята C. platani также были эффективны для AIT, где минимальное количество грибковой ДНК составляло от 1,2 × 10 -2 до 1,4 × 10 -2 пг / мкл, что соответствует количеству обнаруженных пропагул около 10 конидий / мл.

Тесты на патогенность, проведенные в этом исследовании, показали, что минимальное количество грибкового инокулята, необходимое для возникновения заболевания, составляет 10 2 конидий / мл. Выше этих конидиальных концентраций все инокулированные растения проявляли симптомы язвенной болезни, вызывающей синюю окраску, что приводило к гибели растения.Эти концентрации даже ниже, чем те, о которых сообщил Vigouroux (54), который показал, что для развития устойчивых и воспроизводимых симптомов требуется минимум 200 спор C. platani на рану. Более того, эти результаты показали, что представленный здесь метод кПЦР позволяет обнаруживать более низкие концентрации посевного материала, чем те, которые могут вызвать заболевание. Таким образом, этот метод можно использовать для обнаружения скрытых инфекций патогена в бессимптомных вегетативных тканях или естественных насаждениях, улучшая раннее выявление болезни.Эта особенность имеет первостепенное значение для фитосанитарного контроля при торговле растениями, предотвращая или снижая риск распространения болезни.

Глобальная торговля растениями является основной причиной интродукции чужеродных видов, что способствует распространению вредителей и патогенов на большие расстояния (1, 3, 5). Однако распространение патогенов с участием человека также оказывает влияние на местном уровне, способствуя распространению патогенов в районах, где они ранее не были обнаружены. Этот процесс явился причиной распространения Fusarium oxysporum f.sp. canariensis , вызывающий летальное заболевание сосудов финиковых пальм Канарских островов ( Phoenix canariensis ) (55). Грибок может распространяться косвенно во время рубки зараженных растений, и в этом случае зараженные опилки распространялись на расстояние до 100 футов (около 30 м) (56).

C. platani , по-видимому, распространяется главным образом через инфицированные инструменты для обрезки и корневой анастомоз (16), хотя инокулят, переносимый по воздуху, включая споры, опилки и древесные остатки, представляет серьезный риск для открытых свежих ран здоровых платанов.В нашем исследовании мы обнаружили, что использование AIT позволило выявить переносимый по воздуху инокулят C. platani в пределах 200 м от ближайшего зараженного платана с симптомами. Кроме того, с помощью кПЦР удалось обнаружить присутствие C. platani из AIT в окрестностях здоровых платанов, ближайших к зараженному месту.

По этим причинам изучение механизмов распространения инокулята, переносимого по воздуху, важно для более глубокого понимания эпидемиологии этих патогенов.Более того, разработка высокоточных и надежных методов молекулярного обнаружения может помочь избежать вторжения в незагрязненные районы, повысив активность национальных организаций по защите растений (НОКЗР). Использование этих инструментов также оказалось полезным для сравнения распространения по Европе чужеродных патогенов, уже присутствующих в ограниченных зонах, как, например, в случае с C. platani . Жизненный цикл и распространение C. platani строго связаны с деятельностью человека.Для эффективного раннего надзора за этим патогеном и предотвращения его распространения в новые среды существует реальная потребность в быстром, простом и надежном методе обнаружения.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *