Содержание

Кто такие маргиналы — типы и признаки маргиналов

Реализация в социуме – одна из психологических потребностей человека. Личность, выпадающую из социума, называют маргинальной, однако это не означает, что такой человек обязательно беден и ведет саморазрушающий образ жизни. Узнав, кто такие маргиналы, можно с удивлением обнаружить их и среди знакомых.

Кто такой маргинал — определение

По информации социологического толкового словаря, маргинальная личность – это человек, находящийся в пограничном состоянии между двумя или несколькими социальными группами, системами, культурами. Что значит, маргинал – асоциальный субъект, но не обязательно неблагополучный, аморальный или страдающий от патологических привязанностей. Считается, что первыми маргиналами были освобожденные от рабства люди, которые вышли из привычной среды, но стать полноценными членами общества смогли не сразу.

Если маргиналы в обществе не выполняют общественно полезные функции, значит создают разнообразные проблемы. Маргиналы способны сбиваться в группы и устраивать беспорядки. В европейских странах нередко такое явление как бунт мигрантов. Эти люди, которых приняли в чужой стране, обеспечили жильем и питанием, могут приносить множество проблем законопослушным коренным жителям. Несколько реже встречаются безобидные маргиналы, как пример можно привести представителей национальных меньшинств, модного движения дауншифтеров и т.д.

Статус «маргинал» может быть предписан человеку обществом или принят индивидом самостоятельно. «Клеймение» и «навешивание ярлыков» нестандартным людям может произойти в рабочем коллективе, в больнице, в школе. Такого рода вытеснениям часто подвергаются меньшинства – национальные, сексуальные и т.д. Это является нарушением прав человека. Осознать собственную маргинальность индивид может и сам. В данном случае он должен решить – «возвращаться к нормальности» или жить со статусом «маргинал».

Кто такие маргиналы и люмпены?

Термин «люмпен» был введен К. Марксом, к этой группе он относил бродяг, нищих, бандитов. По мнению обывателей — люмпены и маргиналы представляют собой одну группу людей со схожими интересами и образом жизни. Это не совсем так. Люмпен – деклассированный, физически и морально опустившийся элемент, «отброс общества», являющийся частью маргинальной группы, но при этом маргинальная личность далеко не всегда является люмпеном.

Признаки маргиналов

Основным признаком маргиналов социологи называют разрыв экономических, социальных и духовных связей, существующих в «домаргинальной» жизни. В основном маргиналами становятся мигранты, беженцы. Оказаться на краю социальных групп может бывший военный, уволенный со службы, но еще не нашедший себя в гражданском обществе. Связи с прошлым при увольнении разорвались, а новых еще нет, а в особо неблагополучных условиях – и не будет. Тогда человек может деклассироваться – т.е. опуститься на самое «дно» жизни.

Другие признаки маргинальности:

  • мобильность – возникает при отсутствии жилья, привязанностей;
  • психические проблемы – появляются вследствие невозможности найти свое «место под солнцем»;
  • выработка собственных ценностей, иногда враждебность к существующему обществу;
  • достаточная легкость вовлечения в противоправную деятельность.

Типы маргиналов

При позитивном развитии событий период маргинальности у человека длится не слишком долго – адаптировавшись, трудоустроившись, влившись в общество, он теряет статус маргинала. Исключение составляют люди, ставшие маргиналами вынуждено (беженцы) или те, кто сознательно избрал такой образ жизни (бродяги, радикалы, экстремисты, революционеры). Социологи так разделяют основные виды маргиналов: политические, этические, религиозные, социальные, экономические, биологические.

Политические маргиналы

Чтобы понять кто такой политический маргинал, значение этого термина, можно вспомнить период прихода к власти Фиделя Кастро на Кубе, сопровождающийся кровавыми репрессиями. «Остров свободы» стал невыносимым для жизни порядка 2 млн человек, которые сбежали в другие страны, став, по сути, политическими маргиналами – людьми, которых не устраивает существующий политический режим, его законы.

Этнические маргиналы

К людям, на которых распространяется этническая маргинальность, обычно относят индивидов, рожденных от представителей разных национальностей. Не любой межнациональный брак порождает маргиналов, это происходит лишь тогда, если ребенок не соотносит себя ни с одной национальностью родителей – его в таком случае нигде и не принимают. Еще один ответ на вопрос кто такие этнические маргиналы – это национальные меньшинства, представители крайне малочисленных народностей, живущие среди других национальностей.

Религиозные маргиналы

Основная масса людей в обществе или придерживается определенной конфессии, или вообще не верит в бога. Религиозными маргиналами называют индивидов, которые верят в существование высшей силы, но не могут назвать себя представителями ни одной существующей религии. Среди таких индивидов (пророков) можно встретить тех, кто собрал единомышленников и создал собственную церковь.

Социальные маргиналы

Такое явление как социальная маргинальность развивается в обществе, переживающем катаклизмы: перевороты, революции и т.д. Целые группы людей в меняющимся социуме теряют свое место и не могут найти его в новой системе. Такие социальные маргиналы зачастую становятся мигрантами, как пример можно вспомнить представителей дворянского сословия, уехавших из России после революции 1917 года.

Маргинал экономический

Ответ на вопрос, кто такой экономический маргинал, в основном сводится к безработице и сопутствующей этому явлению бедности. Экономические маргиналы вынуждено или намеренно теряют возможность зарабатывать и живут за чужой счет – получая помощь окружающих, пособия от государства, подаяние и т.д. В современном обществе к экономическим маргиналам причисляют и свехбогатых людей, которые также оторваны от общества.

Биомаргиналы

Идеальная общественная организация подразумевает заботу о тех, кто оказался в сложной ситуации из-за проблем со здоровьем, поэтому вопроса кто такой маргинал биологический не должно и возникать. На деле те, кто не имеет ценности для общества из-за нездоровья, оказываются полностью незащищенными. К биомаргиналам относят инвалидов, хронически больных, стариков, ВИЧ-инфицированных, детей с синдромом Дауна и т.д.

Плюсы и минусы маргинальности

Изначально негативное значение термина «маргинал» уже изменилось и не всегда несет отрицательную нагрузки. Быть вне «стада», отличаться от многих – это модно и даже престижно, но положительные стороны маргинальности можно найти даже в классическом значении этого явления:

  • маргиналы более мобильны, чем обычные люди, им легче переехать в экономически более благополучный район, найти более высокооплачиваемую работу, сменить профессию;
  • благодаря своей несхожести с другими членами общества, некоторые маргиналы могут построить на этом свой бизнес, например, этнический маргинал может открыть магазин с товарами, которые производит его народ;
  • благодаря своей гибкости маргиналы часто привносят в общество что-то новое, прогрессивное.

К отрицательным моментам маргинальности можно отнести тот факт, что это явление в основном связано с радикальными изменениями структуры общества – реформами, революциями. В целом общество всегда страдает от таких изменений – государство беднеет, его покидают перспективные личности. Еще один минус маргинализации общества – в снижении уровня жизни и безопасности из-за люмпенизации большого количества маргиналов.

Отрицательна маргинальность и в случае, когда ее искусственно создают. При длительных революциях, войнах, число маргиналов растет в геометрической прогрессии, в результате гибнут и опускаются «на дно» невинные люди. Примерами вынужденной маргинализации являются холокост еврейской нации, устроенный фашистской Германией и сталинские репрессии, в результате которых были сосланы, переселены, лишены работы и жилья сотни тысяч людей.

Маргинальность и бедность

Поскольку в современном обществе ответ на вопрос кто такие маргиналы сильно изменился, далеко не всегда последствия маргинальности – бедность, лишение свободы или даже жизни. Маргиналами, как уже упоминалось, могут быть и очень богатые люди, которые в силу своей обеспеченности более свободны, чем другие члены общества. И нередки случаи, когда успешные бизнесмены уходят от дел и уезжают из больших городов в провинцию, в деревни.

В рамках такого явления как маргинальность стоит упомянуть и о не так давно появившихся дауншифтерах. С рождения индивид развивается в двух противоположных направлениях – как социальная и как индивидуальная личности. В идеале эти силы должны быть уравновешены, но в реальности одно из этих направлений зачастую перевешивает. При усилении социализации рождается конформист, а при усилении индивидуализации может родиться дауншифтер.

Дауншифтер – это человек, избравший жизнь вне общества или сильно ограничивший общение с людьми вне своей семьи. Это маргинал, которого вполне устраивает его нахождение в пограничном состоянии, когда он свободен передвигаться по миру, жить полностью независимо. Чаще всего дауншифтеры предпочитают заниматься искусством – рисуют, пишут книги и т.д. И их творчество почти всегда востребовано, т.к. автор обладает сильной энергетикой и нестандартным мышлением.

 

социол. дз3

Представляется интересной попытка стратифицировать общества, исторические и современные, с помощью типологии стратификационных систем, предпринятая В. Радаевым. Любое общество может быть представлено, по мнению исследователя, как совокупность нескольких стратификационных систем, отличающихся особенностями дифференцирующих общество факторов, различными механизмами социального неравенства и его воспроизводства. Ниже представлены 9 таких систем, выделенных по характеру расслоения, неравенства, хотя их может быть и больше. Основные черты стратификационных систем Тип системы -> Основа дифференциации -> Способ детерминации социальных различий -> Механизм передачи статуса

Физико-генетическая -> Пол, возраст, физические данные -> Физическое принуждение, обычай -> Биологическое наследование Рабовладельческая -> Права гражданства и собственности -> Военное принуждение, кабальное право, продажа в рабство -> Социальное наследование Кастовая -> Религиозное и этническое разделение труда -> Религиозный ритуал, этническая замкнутость -> Социальное наследование Сословная -> Обязанности перед государством по выполнению важных функций Правовое оформление -> Социальное наследование Этакратическая -> Ранги во властной иерархии (политической, военной, хозяйственной) -> Военно-политическое господство -> Не наследуется. Возможен протекционизм Социально-профессиональная -> Род занятий, квалификация -> Образовательные сертификаты, корпоративная мораль -> Не наследуется

Классовая -> Размеры доходов и собственности -> Рыночный обмен -> Не наследуется. Возможно использование института майората Культурно-символическая -> Сакральное знание, доступ к информации -> Религиозное, научное, идеологическое манипулирование -> Не наследуется Культурно-нормативная -> Нормы поведения, стиль и образ жизни -> Моральное регулирование, подражание, идеологический контроль -> Не наследуется Эти системы имеют широкое основание в историческом развитии, хотя не всегда совпадают с соответствующими типами общественного устройства. Они сохраняются в любом обществе, и совокупность представляющих их факторов в каждом конкретном случае своя. Общество, по мнению В. Радаева, может быть описано, как определенная конфигурация, констелляция («созвездие») систем. Высокий или низкий статус групп в одной системе может подкрепляться таким же статусом в другой. Статус богатых (классовый) подкрепляется особым стилем жизни (культурно-нормативный статус), обладанием информацией (символический капитал), профессиональными успехами (квалификационный статус) или просто хорошими физическими данными (статус «крутого», «звезды спорта») и т.д. В большей или меньшей степени подобные системы представлены и в стратификационной картине постсоветской России, где исторически наследовался приоритет статуса в этакратической системе, лишь за ним шли статусы экономические, культурные и др. Проблема социологии — как их адекватно описать.

Россия пережила минимум две крупные волны маргинализации. Первая наступила после революции 1917 г. Из социальной структуры насильственно были выбиты два класса – дворянство и буржуазия, входившие в элиту общества. Новая пролетарская элита стала формироваться из низших классов. Красными директорами и министрами в одночасье стали рабочие и крестьяне. Минуя обычную для стабильного общества траекторию социального восхождения через средний класс, они перескочили одну ступеньку и не попали бы в будущем.

По существу, они оказались теми, кого можно назвать восходящими маргиналами. Они оторвались от одного класса, но не стали полноценными, как это требуется в цивилизованном обществе, представителями нового высшего класса. У пролетариев сохранились прежние манеры поведения, ценности, язык, культурные обычаи, свойственные низам общества, хотя они искренне старались приобщиться к художественным ценностям высокой культуры, обучались грамоте, ходили в культпоходы, посещали театры и агитационные студии.

Путь «из грязи в князи» сохранился вплоть до начала 70-х годов, когда советские социологи впервые установили, что все классы и слои нашего общества теперь воспроизводятся на собственной основе, т.е. только за счет представителей своего класса. Так продолжалось всего два десятилетия, которые можно считать периодом стабилизации советского общества и отсутствия массовой маргинализации.

Вторая волна наступила в начале 90-х годов и также в результате качественных изменений социальной структуры российского общества.

Возвратное движение общества о социализма к капитализму привело к радикальным изменениям в социальной структуре. Элита общества сформировалась их трех пополнений: криминалитета, номенклатуры и «разночинцев». Определенная часть элиты пополнилась из представителей низшего класса: бритоголовые прислужники российских мафиози, многочисленные рэкетиры и оргпреступники часто являли собой бывших пэтэушников и недоучек. Эпоха первоначального накопления, ранняя фаза капитализма, вызвала к жизни брожение по всех слоях общества. Путь к обогащению в этот период как правило, лежит вне правового пространства. Среди первых начали обогащаться и те, кто не имел высокого образования., высокой нравственности, но вполне олицетворял «дикий капитализм».

В элиту вошли, кроме представителей низов, «разночинцы», т.е. выходцы из разных групп среднего советского класса и интеллигенции, а также номенклатура, которая в нужное время оказалась в нужном месте, а именно у рычагов власти, когда предстояло делить общенародную собственность. Напротив, преобладающая часть среднего класса совершила нисходящую мобильность и пополнила ряды бедных. В отличие от старых бедных, существующих в любом обществе, эту часть называют «новыми бедными». Они влияют специфическую черту России. Такой категории бедных нет ни в Бразилии, ни в США, ни в какой иной стране мира. Первая отличительна черта – высокий уровень образования. Учителя, преподаватели, инженеры, врачи и другие категории бюджетников оказались среди бедных только по экономическому критерию – доходам. Но они не являются таковыми по другим, более важным критериям, связанным с образованием, культурой и уровнем жизни. В отличие от старых, хронических бедных «новые бедные» — временная категория. При любом изменении экономической ситуации в стране в лучшую сторону они готовы моментально вернуться в средний класс. И детям они стараются дать высшее образование, привить ценности элиты общества, а не «социального дна»

Маргиналы

Маргинал (от французского marginal, латинское margo – край, граница) – 1) это человек, имеющий отношение к двум различным социальным группам, не принадлежа ни к одной из них полностью; 2) человек, оказавшийся по своему положению вне определенного социального слоя, группы.

Примеры маргинальности: 1) человек, недавно переехавший жить в город из деревни; 2)горожанин, работающий в деревне после окончания института; 3) представитель азиатской страны, приехавший на заработки в европейское государство.

Типы маргиналов: 1) этномаргиналы — возникают в результате миграции в чужую этническую среду;

2) социомаргиналы — появляются в связи с незавершённостью социального перемещения;

3) экономические маргиналы — порождены потерей работы и материального благополучия;

4) политические маргиналы — возникают вследствие утраты общепринятых норм и ценностей политической культуры;

5) регилиозные маргиналы — лица, стоящие вне традиционных конфессий;

6) биомаргиналы — люди,чьё здоровье перестайт быть предметом заботы со стороны государства.

отрицательные стороны маргинальности:

Маргиналы испытывают большое психологическое напряжение и переживают своеобразный кризис самосознания, связанный с утратой социальной идентичности. У них могут проявляться такие черты, как повышенное беспокойство, возбудимость, агрессивность, стремление обойти закон и т.д.

Положительные стороны маргинальности:

1) отсутствие жестко очерченных норм и связей способствует повышению социальной активности личности;

2) маргиналы более восприимчивы к культурным и социальным нововведениям;

3) маргиналы легче адаптируются к постоянно изменяющимся условиям жизни.

4) маргиналы играют крайне важную роль в образовании новых социальных общностей (религиозных, профессиональных и т. д.).

Положительные и отрицательные стороны маргинальности. Маргинальность обычно связана с болезненными психологическими переживаниями. Ее можно рассматривать как негативное явление. И действительно, находиться за пределами общества – это далеко не самое приятное из того, что есть в жизни. Такое положение опасно, поскольку человек может начать чувствовать себя лишним, ненужным. С другой стороны, именно это положение может стать толчком, который заставит человека прилагать усилия и либо приспосабливаться к обществу, восстанавливать свое положение в нем, либо изменять общественную структуру. Маргиналы играют крайне важную роль в образовании новых социальных общностей (религиозных, профессиональных и т. д.) . Между возникновением больших масс людей, по каким-то причинам оказавшихся за пределами привычного уклада жизни, и появлением новых социальных образований существует тесная связь, которая неоднократно отмечалась социологами.

ЕГЭ по обществознанию 2021 задание 23: номер 41

Кто такие маргиналы и какова их роль в обществе? Изначально термином «маргинальность» обозначалось убыточное, экономически близкое к пределу состояние человека, социальной группы. Впервые этот термин употребил американский социолог Роберт Парк в 1928 году. Маргинальность означала положение индивидов, которые находились на границе двух конфликтующих между собой культур. Таким образом, сначала главной проблемой маргинальности был культурный конфликт. Но в 1940–1960-е годы концепция маргинальности стала активно разрабатываться в американской социологии и перестала ограничиваться культурными и расовыми гибридами.

Маргинальность — это состояние в процессе перемещения индивида или группы, а также характеристика социальных групп, которые находятся в промежуточном положении социальной структуры. К маргинальности также относится разрыв социальных связей между обществом и индивидом. По мнению социологов, причиной возникновения социальных маргиналов является переход общества от одной социально-экономической системы к другой. При этом из-за неуправляемого перемещения большой массы людей разрушается устойчивость прежней социальной структуры. В связи с этим наблюдается понижение значения традиционных норм и ухудшение материального уровня жизни. Таким образом, маргиналами в обществе считаются люди, избегающие или отрицающие общественные устои. Современные маргиналы — это личности, социальные слои или группы, которые находятся за рамками характерных для данного общества социально-культурных норм и традиций.

Существует множество групп маргиналов в обществе. Вот некоторые из них: этномаргиналы — национальные меньшинства; социомаргиналы — группы людей в процессе незаконченного социального перемещения; политические маргиналы — таких людей не устраивают легитимные правила и легальные возможности общественнополитической борьбы; биомаргиналы — их здоровье перестаёт быть предметом заботы общества; возрастные маргиналы — формируются при разрыве связей между поколениями. В настоящее время маргинализация не является прогрессирующим процессом, но она оказывает значительное влияние на жизнь общества.

Общество маргиналов, как правило, является для любого государства большой проблемой, так как они не выполняют никаких полезных действий в новом формате взаимоотношений. Кроме того, такие личности опасны тем, что они сплачиваются и начинают предпринимать разнообразные протесты против нынешней системы. Маргиналы часто создают свои идеологии: фашизм, коммунизм, анархизм и т. д. Кто такой маргинал на самом деле? Обычный бунтарь или жертва обстоятельств? В сущности, трудно сказать однозначно, ведь путь каждого человека, который стал маргиналом, имеет свои особенности. По-видимому, сначала человек просто оказывается в неблагоприятных условиях для ведения нормальной жизни, а уже позже такое положение вещей выливается в определённый конфликт с обществом и с самим собой.

(А. Радунин)

Назовите наиболее распространённые в обществе группы маргиналов. Используя обществоведческие знания, факты общественной жизни и личный социальный опыт, приведите конкретные примеры маргиналов каждой группы.

Виды социальной мобильности — Социология

Поможем написать любую работу на аналогичную тему

Получить выполненную работу или консультацию специалиста по вашему учебному проекту

Узнать стоимость

 

Понятие социальной мобильности ввел в социологию П. Сорокин.

Социальной мобильностью называется совокупность социальных перемещений людей в обществе.

Существуют два основных вида социальной мобильности — межпоколенная и внутрипоколенная, и два основных типа – вертикальная и горизонтальная.

Межпоколенная мобильность предполагает, что дети достигают более высокой социальной позиции либо опускаются на более низкую ступеньку, чем их родители: сын шахтера становится инженером.

Внутрипоколенная мобильность означает, что один и тот же индивид, вне сравнения с родителями, на протяжении жизни несколько раз меняет социальные позиции: токарь становится инженером, а затем начальником цеха, директором завода, министром машиностроительной отрасли.

Вертикальная мобильность подразумевает перемещение из одной страты (сословия, класса, касты) в другую, т.е. перемещение, приводящее к повышению или к понижению социального статуса.

В зависимости от направления перемещения вертикальная мобильность бывает восходящая (социальный подъем, движение вверх) и нисходящая (социальный спуск, движение вниз). Как правило, восхождение — явление добровольное, а нисхождение — принудительное.

Горизонтальная мобильность подразумевает перемещение индивида из одной социальной группы в другую без повышения или понижения социального статуса: перемещение из православной в католическую религиозную группу, из одного гражданства в другое, из одной семьи (родительской) в другую (свою собственную, вновь образованную), из одной профессии в другую.

Разновидностью горизонтальной мобильности служит географическая мобильность, подразумевающая не изменение статуса или группы, а перемещение из одного места в другое при сохранении прежнего статуса.

Различают индивидуальную мобильность — перемещения вниз, вверх или по горизонтали происходят у каждого человека независимо от других, и групповую мобильность — перемещения происходят коллективно.

Выделяют также организованную мобильность и структурную мобильность. Организованной мобильность является, когда перемещения человека или целых групп вверх, вниз или по горизонтали управляются государством: а) с согласия самих людей, б) без их согласия.

Структурная мобильность вызвана изменениями в структуре общества и происходит помимо воли отдельных индивидов.

Виды (типы, формы) мобильности могут быть главные и неглавные.

Главные виды характеризуют все или большинство обществ в любую историческую эпоху.

Неглавные виды мобильности присущи одним типам общества и не присущи другим.

Вертикальная социальная мобильность измеряется при помощи двух главных показателей: дистанция мобильности и объем мобильности.

Дистанция мобильности — количество ступенек, на которые удалось подняться или пришлось спуститься индивидам. Нормальной дистанцией считается перемещение на одну-две ступени вверх или вниз. Большинство социальных перемещений происходит именно так. Ненормальная дистанция — неожиданный взлет на вершину социальной лестницы или падение к ее основанию.

Под объемами мобильности понимается число индивидов, которые переместились по социальной лестнице в вертикальном направлении за определенный промежуток времени. Объем, исчисляемый количеством переместившихся индивидов, называется абсолютным, а отношением этого количества по всему населению — относительным объемом и указывается в процентах. Совокупный объем, или масштаб мобильности, определяет количество перемещений по всем стратам вместе, а дифференцированный — по отдельным стратам, слоям, классам.

Групповая мобильность наблюдается там и тогда, где и когда повышается или понижается общественная значимость целого класса, сословия, касты.

Причинами групповой мобильности чаще всего выступают следующие факторы:

• социальные революции,

• иностранные интервенции, нашествия,

• гражданские войны,

• военные перевороты,

• смена политических режимов,

• замена старой конституции новой,

• крестьянские восстания,

• междоусобная борьба аристократических родов,

• создание империи.

Групповая мобильность имеет место там, где происходит изменение самой системы стратификации.

На социальную мобильность наибольшее влияние оказывают не профессия и образование родителей, а собственные достижения в обучении. Чем выше образование, тем больше шансов продвинуться вверх по социальной лестнице. Большинство людей начинают свою трудовую карьеру на одинаковом с родителями социальном уровне и лишь очень немногим удается значительно продвинуться вперед.

Средний гражданин за жизнь перемещается на одну ступеньку вверх или вниз, редко кому удается шагнуть сразу на несколько ступеней.

Факторы восходящей индивидуальной мобильности, т. е. причины, позволяющие одному человеку достичь больших успехов, чем другому:

• социальный статус семьи,

• уровень полученного образования,

• национальность,

• физические и умственные способности, внешние данные,

• полученное воспитание,

• место жительства,

• выгодный брак.

Во всех индустриально развитых странах женщине продвинуться сложнее, чем мужчине. Часто женщины повышают свой социальный статус благодаря выгодному замужеству. Поэтому, устраиваясь на работу, они выбирают такие профессии, где вероятнее всего найти «подходящего мужчину».

В индустриальном обществе мобильность определяется структурой народного хозяйства. На вертикальную и горизонтальную мобильности влияют пол, возраст, уровень рождаемости, уровень смертности, плотность населения.

Молодые и мужчины более мобильны, чем пожилые и женщины. Молодым свойственна профессиональная, взрослым — экономическая, пожилым — политическая мобильность.

Чем выше человек поднимается по социальной лестнице, тем меньше детей у него рождается.

Страты, как страны, могут быть перенаселены или недонаселены.

Каналы вертикальной мобильности.

Между стратами нет непроходимых границ. Между ними существуют различные «отверстия», «лифты», «мембраны», по которым индивиды перемещаются вверх и вниз.

В качестве каналов социальной мобильности используются социальные институты.

Армия функционирует в качестве канала особенно эффективно в военное время. Крупные потери среди командного состава приводят к заполнению вакансий из нижних чинов. Солдаты продвигаются благодаря таланту и храбрости. Повысившись в звании, они используют полученную власть как канал для дальнейшего продвижения и накопления богатств.

Церковь как канал социальной мобильности переместила большое число людей с низов до вершин общества. Помимо восходящей мобильности церковь была каналом и нисходящей. Тысячи еретиков, язычников, врагов церкви были отданы под суд, разорены и уничтожены.

Институт образования, какую бы конкретную форму он ни приобретал, во все века служил мощным каналом социальной мобильности.

Семья и брак становятся каналами вертикальной мобильности в том случае, если в союз вступают представители разных социальных слоев. В античности по римским законам свободная женщина, вышедшая замуж за раба, сама становилась рабыней и теряла статус свободного гражданина.

Возведение социальных барьеров и перегородок, ограничение доступа в другую группу либо замыкание группы в самой себе называется социальной клаузулой (групповой замкнутостью).

В молодом быстро развивающемся обществе вертикальная мобильность идет очень интенсивно. Выходцы из низших классов благодаря счастливым обстоятельствам, трудолюбию или изворотливости быстро продвигаются наверх, где для них уготовано множество вакансий. Места заполняются, движение вверх замедляется. Новый класс богачей отгораживается от общества множеством социальных барьеров. Попасть в него теперь неимоверно сложно. Социальная группа закрылась.

В процессе социальной мобильности в обществе неизбежно формируются особые страты людей, которые утрачивают важные социальные статусы и роли и какое-то время не приобретают адекватные им статусы и роли.

Такие социальные страты ученые называют маргиналами.

Под маргиналами понимаются индивиды, их группы и общности, формирующиеся на границах социальных слоев и структур, в рамках процессов перехода от одного типа социальности к другому или в пределах одного типа социальности при его серьезных деформациях.

Среди маргиналов могут быть

этномаргиналы, сформированные миграциями в чужую среду или выросшие в результате смешанных браков;

биомаргиналы, чье здоровье перестает быть предметом заботы социума;

социомаргиналы, например, группы находящихся в процессе незавершенного социального перемещения;

возрастные маргиналы, формирующиеся при разрыве связей между поколениями;

политичеcкие маргиналы, которых не устраивают легальные возможности и легитимные правила общественно-политической борьбы;

экономические маргиналы традиционного (безработные) и нового типа — так называемые «новые безработные»;

религиозные маргиналы — стоящие вне конфессий или не решающиеся осуществить выбор между ними;

криминальные маргиналы, а также те, чей статус в социальной структуре не определен.

«Люмпенами» называются все деклассированные слои населения (бродяги, нищие, уголовные элементы и другие).

Люмпен — это лицо, не имеющее никакой собственности и живущее случайными заработками.

 

 

 

 

 

 

 

Внимание!

Если вам нужна помощь в написании работы, то рекомендуем обратиться к профессионалам. Более 70 000 авторов готовы помочь вам прямо сейчас. Бесплатные корректировки и доработки. Узнайте стоимость своей работы.

Кто такие маргиналы?


На сегодняшний день слово «маргинал» является модным, но весьма неопределённым с точки зрения своего значения. Люди порой произносят его, не догадываясь о настоящем значении, но считают его весьма и весьма уместным. Историки говорят о том, что первыми маргиналами можно смело называть рабов, которые получили впоследствии свободу. Эти рабы не были приспособлены жить как свободные граждане и просто морально и психологически не были готовы к таким переменам. Можно привести пример современного маргинала, это особая категория немолодых людей, которые отсидели в тюрьме как минимум лет десять, и теперь вышли на свободу. Условия для них новые, однако, они не умеют и не знают, как в них существовать и снова в скором времени возвращаются обратно в места, которые приютили их на эти долгие годы.

Известный факт, что люди, которые в обществе совершенно никаких функций не выполняют, начинают со временем активно объединять свои усилия. Именно поэтому, маргиналами очень часто называют персон, которые относятся к разным классам. Отдельные люди, которых можно смело назвать остатками, личности, покинувшие историческую сцену и которые пока ещё не сумели найти себя в жизни. Обычно маргиналами называют необразованную категорию граждан, которая не может брать на себя какие-то системные функции и всё из-за общей неосведомлённости в процессе руководства и принятия важных решений. Государство часто выделяет общество маргиналов и акцентирует внимание на том, что они являются для страны особой проблемой. Всё дело в том, что маргиналы ничего полезного не делают, если рассматривать этот вопрос в формате активного взаимодействия общества и людей. Эти люди опасны, они часто устраивают акции протестов против системы и полагают, что они правильно делают. Маргиналы продвигают в массы свои идеологии: коммунизм, фашизм, анархизм и др.

Обычно в категорию маргиналов заносят беженцев, а также мигрантов.
Люди, которые оказались на окраинах социальных групп, уволенный со службы военный, который пока ещё не определился чем именно, он будет заниматься по жизни. Среди иных признаков маргинальности стоит выделить такие характеристики как: ряд психологических проблем – человек просто никак не может найти себя и своё «место под солнцем»; мобильность – если нет каких-либо привязанностей, а также отсутствует жильё; собственные ценности. В таки ситуациях даже возникает некоторая враждебность к обществу, которое существует;
Можно выделить основные типы маргиналов

политические маргиналы. Данный термин можно смело применить к периоду власти Фиделя Кастро на Кубе. Время его правления сопровождалось кровопролитием, остров покинули более 2 миллионов человек, которые пытались спасти свои жизни бегством. Они стали политическими маргиналами, так как их не устроил режим и законы;

этнические маргиналы. Можно отнести в эту категорию людей, которые были рождены от представителей разных национальностей. Но маргиналом себя может назвать ребёнок лишь в том случае, если он не относит себя ни к одной из национальностей родителей и его нигде не признают. Историки называют этническими маргиналами представителей национальных меньшинств, которые разбросаны по всему свету;

религиозные маргиналы. Если весь мир придерживается какой-то одной конфессии, а отдельные персоны верят в существование другой высшей силы и активно пропагандируют верить в неё – их называют религиозными маргиналами;

маргиналы социальные. Эта категория маргинальности проявляется в тот самый момент, когда в обществе происходят перевороты, революции и оно переживает какие-то исторические катаклизмы. Группы людей не могут найти сой место в социуме и привыкнуть к новой системе власти. Довольно часто такие люди просто покидают страну и отправляются искать счастья за границу;

экономические маргиналы. Обычно такие группы людей не могут найти работу и способствуют только увеличению процента бедности среди населения. Экономические маргиналы пытаются жить за счёт государственных средств, а также подаяния, которое они получают от других людей. В современном обществе к этой категории причисляют также очень богатых людей, которые по сути выступают маргиналами и оторваны от общества;

биомаргиналы. Эту категорию граждан так называют потому, что у них возникли проблемы со здоровьем и они вынуждены были попытаться отыскать способы борьбы со своей проблемой, но ничего не получилось. Они считают, что государство обязано выделять им ежемесячно денежные средства на содержание и лекарственные препараты. Многие биомаргиналы не работают и даже не стремятся искать работу, в связи со своим физическим и психологическим здоровьем.

Маргинальность в истории и современности

Маргиналы

Кого правильно называть маргиналами и почему это не обязательно плохо

Слово «маргинал» наверняка слышал каждый. Мы воспринимаем его как нечто негативное и оскорбительное. Но это определение не имеет в своем значении ничего обидного или ярко выраженного отрицательного. Маргиналов вокруг довольно много и вы будете удивлены, узнав, что к этой группе людей относятся ваши знакомые или даже вы сами.

В нашем понимании маргинал – это человек, ведущий саморазрушающий образ жизни, бедный и отмеченный печатью деградации. Но достаточно посмотреть определение этого слова, чтобы понять свою ошибку. Энциклопедия говорит нам, что маргиналы – это люди, находящийся в пограничном состоянии между двумя или несколькими социальными группами, системами, культурами. То есть это асоциальные личности, но совсем необязательно аморальные и опустившиеся.

Маргинал – это плохо?

Ученые утверждают, что первыми в истории маргиналами были освобожденные рабы. Они покинули привычное для себя сообщество, но быстро и безболезненно влиться в новую для себя среду свободных людей не могли. Примерно так же происходит сегодня с мигрантами, прибывшими из стран Африки и Азии в Европу – они чувствуют себя чужими и очень трудно находят свое место на чужбине.

Маргиналы, которые не могут выполнять в обществе полезные функции, очень часто становятся источниками серьезных проблем. Они собираются в группировки и устраивают массовые беспорядки, уходят в криминал или постепенно «скатываются по наклонной» и опускаются, заполнив пустоту в своей жизни алкоголем и наркотиками.

При этом часто таких людей достойно принимают в других странах, обеспечивая жильем и питанием. Маргиналы не всегда бывают за это благодарны и нередко создают серьезные проблемы живущим рядом добропорядочным гражданам. Но есть и безобидные представители этой группы, живущие в своем мире и придерживающиеся особой жизненной философии, например, дауншифтеры.

Не всегда человек сам выбирает себе статус маргинала. Иногда за него это делает общество и для этого не всегда нужен объективный повод. Известны примеры маргинализации по сексуальной ориентации, национальности, а также частные случаи в школе, университете или на работе. Большинство отказывается принимать человека или группу людей, отличающихся от него, и это считается нарушением прав человека.

Бывают случаи, когда человека сам осознает свою маргинальность и ее причины. В таком случае он может оставить все как есть или вернуться к «нормальной» жизни, то есть принять правила большинства. Иногда это получается, а иногда нет – все зависит от конкретной ситуации и от самого человека.

Чем отличаются маргиналы от люмпенов

Популярный в советские времена термин «люмпен» был введен Карлом Марксом. В эту группу теоретик социализма включал людей, ведущих асоциальный образ жизни – бродяг, нищих, преступников. Для многих люмпены и маргиналы – это одно и то же, но это ошибочное мнение. Люмпен – это деклассированный элемент, человек без морали и часто одержимый пороками.

Маргинальная личность может быть люмпеном, но это необязательное условие. Общее у этих категорий людей то, что они выпадают из устойчивой социальной структуры. Впрочем, следует признать, что путь из маргиналов в люмпены гораздо короче, чем из других социальных групп.

Чтобы отличать маргиналов от люмпенов, нужно рассмотреть основные признаки маргинальности. К ним относится мобильность, связанная с отсутствием жилья и привязанностей, психологические проблемы, вызванные невозможностью найти свое место в обществе. Выработка собственной системы ценностей, которая часто враждебна к существующему обществу. К сожалению, нужно сказать, что и легкое вовлечение в преступную деятельность – тоже один из признаков маргинальности.

Типы маргиналов

Маргинальность проявляется по разным причинам, поэтому принято различать несколько типов маргиналов. Самый распространенный тип – это политические маргиналы, оказавшиеся на краю из-за действий руководства своей страны. Хороший пример – Куба, где после прихода к власти Фиделя Кастро более двух миллионов людей оказались всемирными изгоями. Кровавые репрессии и полное бесправие в стране привели к тому, что граждане стали негативно относиться к своему государству.

Еще один тип маргиналов – этнические. Это люди, по какой-то причине оказавшиеся в чужой стране, окруженные представителями другой национальности. Сегодня это очень распространенное явление, особенно в Европе, куда хлынули беженцы из Африки и Азии. Эти люди не готовы ассимилироваться среди принявшего их населения, что создает определенные проблемы.

Этническим маргиналом может быть и ребенок, рожденный от родителей разных национальностей и рас. Он может быть не принят ни одним этническим сообществом и в этом случае будет обречен на жизнь на самом краю общества. В основном такое явление характерно для слаборазвитых стран, где сильны предрассудки и влияние религиозных канонов.

Стоит упомянуть и религиозных маргиналов. Это люди, которые исповедуют свои, не слишком популярные религии и культы и тем самым выделяются из общей массы. Среди религиозных маргиналов нередко встречаются личности, способные увлечь за собой массы. В этом случае появляются новые культы и секты.

Социальные маргиналы потеряли своем место в обществе из-за каких-то потрясений, например, переворотов, кризисов и революций. В качестве примера можно привести дворянское сословие России, которое полностью маргинализировалось после революции 1917 года, так и не сумев принято ценности нового, чуждого им пролетарского общества. Они были вынуждены эмигрировать, но и на чужбине остались маргиналами.

Экономические маргиналы – это те, кто остался по какой-то причине без средств к существованию. Это люди, потерявшие работу или не желающие работать и поэтому живущие за чужой счет. Они просят милостыню, живут за счет государственной помощи или просто «сидят на шее» у работающего члена семьи или у родителей. Часто этил личностей устраивает такой образ жизни.

Биомаргиналы – это тип людей, которые не имеют ценности для общества из-за недугов или физических недостатков. В цивилизованных странах о них заботятся, но если этого не происходит, инвалид быстро маргинализируется. К этой категории принято относить инвалидов, хронически больных, стариков, ВИЧ-инфицированных, людей с синдромом Дауна.

Есть ли у маргинальности плюсы?

Как ни странно, но маргиналы часто вносят весомый вклад в жизнь общества, которое их не приняло. Среди них много творческих и одаренных людей – музыкантов, художников, литераторов. Еще одной положительной стороной маргинальности можно считать гибкость, отсутствие привязанности к месту и людям.

Маргиналу проще уехать в другой город и даже в другую страну, более благополучную, где заново начать жизнь и добиться успеха. Этнические маргиналы, живущие в странах с чуждой им культурой, часто становятся владельцами ресторанов национальной кухни или магазинов экзотических товаров.

Подводя итог, можно сказать, что ярко выраженную отрицательную окраску имеет только искусственно созданная маргинальность. В этом случае опускаются на самое дно и даже гибнут невинные люди и целые народы. Принудительная маргинализация евреев в нацистской Германии привела к погромам, ненависти и в итоге к Холокосту, погубившему миллионы жизней.

Смотрите также — Город стариков Сан-Сити на фото Кендрик Бринсон

А вы знали, что у нас есть Instagram и Telegram?

Подписывайтесь, если вы ценитель красивых фото и интересных историй!

Прочитайте текст и выполните задания 21-24.

Кто такие маргиналы, и какова их роль в обществе? Изначально для обозначения записей на полях употреблялся термин «маргинальный». Впервые этот термин употребил американский социолог и один из основателей чикагской школы Роберт Эзра Парк в 1928 году. У Парка маргинальность означала положение индивидов, которые находились на границе двух конфликтующих между собой культур. Таким образом, сначала главной проблемой маргинальности был культурный конфликт. Но в 1940-1960-е годы концепция маргинальности стала активно разрабатываться в американской социологии и перестала ограничиваться культурными и расовыми гибридами.

Маргинальность — это состояние в процессе перемещения индивида или группы, а также характеристика социальных групп, которые находятся в промежуточном положении социальной структуры. К маргинальности также относится разрыв социальных связей между обществом и индивидом. По мнению социологов, причиной возникновения социальных маргиналов является переход общества от одной социально-экономической системы к другой. При этом из-за неуправляемого перемещения большой массы людей разрушается устойчивость прежней социальной структуры. В связи с этим наблюдается девальвация традиционных норм и ухудшение материального уровня жизни. Таким образом, маргиналами в обществе считаются люди, избегающие или отрицающие общественные устои. Современные маргиналы — это личности, социальные слои или группы, которые находятся за рамками характерных для данного общества социально-культурных норм и традиций.

Существует множество групп маргиналов в обществе, вот некоторые из них: этномаргиналы: национальные меньшинства; социомаргиналы: группы людей в процессе незаконченного социального перемещения; политические маргиналы: таких людей не устраивают легитимные правила и легальные возможности общественно-политической борьбы; биомаргиналы: их здоровье перестаёт быть предметом заботы общества; возрастные маргиналы: формируются при разрыве связей между поколениями; В настоящее время маргинализация не является прогрессирующим процессом, но ей стоит уделять своё внимание, чтобы быть в курсе событий общественной жизни.
Общество маргиналов, как правило, является для любого государства большой проблемой, так как они не выполняют никаких полезных действий в новом формате взаимоотношений. Кроме того такие личности опасны тем, что они сплачиваются и начинают предпринимать разнообразные протесты против нынешней системы. Маргиналы часто создают свои идеологии: фашизм, коммунизм, анархизм и т.п. Кто такой маргинал на самом деле? Обычный бунтарь или жертва обстоятельств? В сущности, трудно сказать однозначно, ведь путь каждого человека, который стал маргиналом, имеет свои особенности. По видимому, сначала человек просто оказывается в неблагоприятных условиях для ведения нормальной жизни, а уж позже такое положение вещей выливается в определенный конфликт с обществом и самим собой.

(А. Радунин)

 

21. Какое значение термина «маргинальность» приводит автор? Какую причину маргинальности он называет? Что означал этот термин у американского социолога Роберта Эзры Парка?

22.Опираясь на знания обществоведческого курса, дайте определения понятию «социальная группа». Как влияет маргинальность на общество в целом? В чем видит автор причины возникновения маргинальности?

23.Назовите наиболее распространенные в обществе группы маргиналов и проиллюстрируйте их примерами.

24. Как вы считаете, маргинал – это обычный бунтарь или жертва обстоятельств? Приведите три аргумента в поддержку своего мнения.

25. Используя обществоведческие знания,

1) раскройте смысл понятия «социальная мобильность».;

2) составьте два предложения:

— одно предложение, содержащее информацию о видах социальной мобильности;

— одно предложение, содержащее информацию о взаимосвязи между социальной мобильностью и типом общества;

(Предложения должны быть распространёнными и содержащими корректную информацию о соответствующих аспектах понятия.)

26. Назовите и проиллюстрируйте примерами любые три метода социологического исследования.

27.Многим из вас с детства известна сказка Ганса Христиана Ан­дерсена о голом короле. Герои этой сказки подчинялись об­щему мнению и грешили против истины, расхваливая то, чего в реальности не существовало. Боязнь быть «не как все», по­лучить наказание за несогласие с общим мнением существует не только в сказке, но и в реальной жизни. Индивид подчи­няется влиянию группы из-за желания остаться её членом. Но это лишь внешнее согласие с группой, внутренняя позиция человека может быть противоположной. Соглашаясь с мнени­ем большинства, он не создаёт проблем в общении, получает поддержку и одобрение группы. С желанием заслужить одоб­рение или избежать порицания и быть принятым в своей груп­пе связано подчинение навязываемому группой мнению.Как называется социально-психологическое явление, о кото­ром говорится в сказке Андерсена? Назовите две его характе­ристики, указанные в тексте задания. Укажите положитель­ную и отрицательную роль данного поведения для самого человека и развития отношений между людьми.

28.Вам поручено подготовить развёрнутый ответ на тему «Социальные общности». Составьте план, в соответствии с которым вы будете освещать эту тему. План должен содержать не менее трех пунктов, из которых два и более детализированы в подпунктах.

29.Выберите одноиз предложенных ниже высказываний и на его основе напишите мини-сочинение. Обозначьте по своему усмотрению одну или несколько основных идей затронутой автором темы и раскройте её (их).

При раскрытии обозначенной(-ых) вами основной(-ых) идеи(-й), в рассуждениях и выводах используйте обществоведческие знания (соответствующие понятия, теоретические положения), иллюстрируя их фактами и примерами из общественной жизни и личного социального опыта, примерами из других учебных предметов.

Для иллюстрации сформулированных Вами теоретических положений, рассуждений и выводов приведите не менее двух фактов /примеров из различных источников. Каждый приводимый факт / пример должен быть сформулирован развёрнуто и явно связан с иллюстрируемым положением, рассуждением, выводом.

29.1.Социология.«Чтобы быть довольным своим положением, необходимо сравнивать его с положением худшим». (Бенджамин Франклин)

29.2.Социология.«Важно не звание человека, а его дело». (Плиний Младший).

29.3.Социология.«Кто стремится занять почетное место среди людей способных, ставит себе трудную задачу, но всегда это на благо обществу; а вот кто замышляет быть единственной фигурой среди пешек, тот позор для своего времени». (Фрэнсис Бэкон).

 

 

определение, значение слова простыми словами, примеры использования

Реализация в обществе — одна из психологических потребностей человека. Человека, выпадающего из общества, называют маргиналом, но это не значит, что такой человек обязательно беден и ведет саморазрушительный образ жизни. Узнав, кто такие маргиналы, вы с удивлением обнаружите их среди друзей.

Кто является маргиналом — определение

Согласно социологическому толковому словарю, маргинальный человек — это человек, находящийся в пограничном состоянии между двумя или более социальными группами, системами, культурами.Это означает, что маргинал является асоциальным субъектом, но не обязательно дисфункциональным, аморальным или страдающим патологическими привязанностями. Считается, что первыми маргиналами стали люди, освободившиеся от рабства, покинувшие привычную среду обитания, но не сумевшие сразу стать полноценными членами общества.

Если маргиналы в обществе не выполняют общественно полезных функций, они создают множество проблем. Маргиналы способны объединяться в группы и вызывать беспорядки.В европейских странах часто встречается такое явление, как бунт мигрантов. Эти люди, усыновленные в чужой стране, обеспеченные жильем и питанием, могут доставить много проблем законопослушным коренным народам. Несколько реже встречаются безобидные маргиналы, например представители национальных меньшинств, модное движение дауншифтеров и т. Д.

«Маргинальный» статус может быть прописан человеку обществом или принят индивидом самостоятельно. «Брендинг» и «навешивание ярлыков» на нестандартных людей может происходить в трудовом коллективе, в больнице, в школе.Такому виду репрессий часто подвергаются меньшинства — национальные, сексуальные и т. Д. Это нарушение прав человека. Индивид может сам осознать свою маргинальность. В этом случае он должен решить — «вернуться к нормальной жизни» или жить в «маргинальном» статусе.

Кто такие маргиналы и люмпены?

Термин «люмпен» ввел Карл Маркс, в эту группу он включал бродяг, нищих, бандитов. По мнению обычных людей, люмпены и маргиналы представляют собой одну группу людей со схожими интересами и образом жизни.Это не совсем правда. Люмпен — это деклассированный, физически и морально деградированный элемент, «отходы общества», входящие в маргинальную группу, но в то же время маргинальный человек не всегда люмпен.

Признаки обездоленных

Социологи говорят, что главным признаком маргинализации является разрыв экономических, социальных и духовных связей, существующих в «предмаргинальной» жизни. По сути, мигранты и беженцы становятся маргиналами. Бывший военный, уволенный со службы, но еще не вошедший в гражданское общество, может оказаться на грани социальных групп.Связи с прошлым при увольнении разорваны, но новых пока нет, а в особо неблагоприятных условиях не будет. Тогда человека можно рассекретить — т.е. опуститься на самое дно жизни.

Другие признаки маргинальности:

  • мобильность — возникает при отсутствии корпуса, навесного оборудования;
  • проблемы с психикой — появляются из-за невозможности найти свое «место под солнцем»;
  • развитие собственных ценностей, иногда враждебного отношения к существующему обществу;
  • достаточная простота вовлечения в противоправную деятельность.

Виды маргиналов

При положительном развитии событий период маргинальности у человека длится недолго — адаптировавшись, найдя работу, приобщившись к обществу, он теряет свой маргинальный статус. Исключение составляют люди, подвергшиеся насильственной маргинализации (беженцы) или сознательно выбравшие такой образ жизни (бродяги, радикалы, экстремисты, революционеры). Социологи так разделяют основные типы маргиналов: политические, этические, религиозные, социальные, экономические, биологические.

Политические маргиналы

Чтобы понять, кто такой политический маргинал, значение этого термина, можно вспомнить период, когда Фидель Кастро пришел к власти на Кубе, сопровождавшийся кровавыми репрессиями. «Остров свободы» стал невыносимым для жизни около 2 миллионов человек, бежавших в другие страны, став, по сути, политическими маргиналами — людьми, которых не устраивает существующий политический режим и его законы.

Этнические маргиналы

К людям, подверженным этнической маргинальности, обычно относятся лица, рожденные от представителей разных национальностей.Не всякий межнациональный брак рождает маргиналов, это происходит только в том случае, если ребенок не соотносит себя ни с одной из национальностей родителей — в этом случае его нигде не принимают. Еще один ответ на вопрос, кто такие этнические маргиналы — это национальные меньшинства, представители крайне малых этносов, проживающие среди других национальностей.

Религиозные маргиналы

Основная часть людей в обществе либо придерживается определенной конфессии, либо вообще не верят в Бога.Религиозные маргиналы — это люди, которые верят в существование высшей силы, но не могут называть себя представителями какой-либо существующей религии. Среди таких личностей (пророков) можно найти тех, кто собрал единомышленников и создал свою церковь.


Социальные маргиналы

Такое явление, как социальная маргинальность, развивается в обществе, переживающем катаклизмы: перевороты, революции и т. Д. Целые группы людей в меняющемся обществе теряют свое место и не могут найти его в новой системе.Такие социальные маргиналы часто становятся переселенцами, в качестве примера можно привести представителей знати, покинувших Россию после революции 1917 года.

Экономическая наценка

Ответ на вопрос о том, кто является экономическим маргиналом, в основном сводится к безработице и сопутствующему явлению бедности. Экономические маргиналы вынуждены или намеренно терять возможность зарабатывать деньги и жить за чужой счет — получать помощь от других, выгоды от государства, милостыню и т. Д.В современном обществе сверхбогатые люди, которые также отрезаны от общества, также считаются экономически изолированными.

Биомаргинальный

Идеальная общественная организация подразумевает заботу о тех, кто оказался в сложной ситуации из-за проблем со здоровьем, поэтому вопрос о том, кто является биологическим маргиналом, возникать не должно. Фактически, совершенно незащищены те, кто не представляет ценности для общества из-за плохого состояния здоровья. Биомаргинальные люди включают людей с ограниченными возможностями, хронически больных, пожилых людей, ВИЧ-инфицированных и т. Д.

Плюсы и минусы маржинальности

Первоначально отрицательное значение термина «маржинальный» уже изменилось и не всегда несет отрицательную нагрузку. Быть вне «стада», отличаться от многих — модно и даже престижно, но положительные стороны маргинальности можно найти даже в классическом понимании этого явления:

  • маргиналы более мобильны, чем обычные люди, им легче переехать в экономически более благополучный район, найти более высокооплачиваемую работу, сменить профессию;
  • из-за их непохожести на других членов общества, некоторые маргинализированные люди могут строить свой бизнес на этом, например, маргинализированный по этническому признаку человек может открыть магазин с товарами, произведенными его людьми;
  • из-за своей гибкости маргиналы часто привносят в общество что-то новое и прогрессивное.

К отрицательным моментам маргинальности можно отнести то, что это явление в основном связано с радикальными изменениями в структуре общества — реформами, революциями. В целом общество всегда страдает от таких изменений — государство становится беднее, из него уходят перспективные люди. Еще один недостаток маргинализации общества — снижение уровня жизни и безопасности из-за люмпенизации большого числа маргинализированных людей.

Отрицательная маржинальность бывает и в том случае, если она создается искусственно.Во время длительных революций и войн количество маргинализированных людей растет в геометрической прогрессии, в результате невинные люди умирают и опускаются на дно. Примерами принудительной маргинализации являются холокост еврейской нации, организованный нацистской Германией, и сталинские репрессии, в результате которых сотни тысяч людей были изгнаны, перемещены, лишены работы и жилья.

Маргинализация и бедность

Поскольку в современном обществе ответ на вопрос о том, кто такие маргиналы, сильно изменился, последствиями маргинальности далеко не всегда становятся бедность, тюремное заключение или даже жизнь.Маргинальные люди, как уже было сказано, тоже могут быть очень богатыми людьми, которые в силу своего богатства более свободны, чем другие члены общества. А успешные бизнесмены нередко уходят на пенсию и уезжают из больших городов в провинции и села.

В рамках такого явления, как маргинальность, стоит упомянуть недавно появившихся дауншифтеров. С рождения человек развивается в двух противоположных направлениях — как социальная личность и как индивидуальная личность.В идеале эти силы должны быть уравновешены, но на самом деле одно из этих направлений часто перевешивает. С усилением социализации рождается конформист, а с усилением индивидуализации может родиться дауншифтер.

Дауншифтер — это человек, который выбрал жизнь вне общества или сильно ограничил общение с людьми за пределами своей семьи. Это маргинальный человек, которого вполне устраивает то, что он находится в пограничном состоянии, когда он может свободно перемещаться по миру, жить совершенно самостоятельно.Чаще всего дауншифтеры предпочитают заниматься искусством — рисуют, пишут книги и т. Д. И их работы практически всегда востребованы, потому что у автора сильная энергетика и.

Социализация — психологическая потребность человека. Ребенок идет в детский сад (первый коллектив), потом в школу, институт, устраивается на работу, чтобы жить в социальной среде. У каждого человека должна быть семья, друзья, разделяющие его интересы.

Если человек вдруг «выпадет» из обычного общества, он станет маргиналом.Это не означает, что человек потерян для общества, опустился на дно или ведет саморазрушительный образ жизни. Поняв, кто такие маргиналы, вы можете узнать в них себя или найти их среди своих знакомых.

Кто такие маргиналы

Маргиналы — это люди вне социальной группы, изгои, отличающиеся от большинства поведением, взглядами на действительность, внешностью. Латинское слово «marginalis» означает «на краю».

Маргиналы — это асоциальный субъект, но не всегда дисфункциональный, аморальный или униженный.Первыми маргиналами были люди, освобожденные от рабства, которые вышли из привычной среды, но не смогли сразу стать полноценными членами общества. В первой трети двадцатого века сельские жители в Америке оказались маргинализованными, они оказались в городах и не могли найти себе применение; люди, которые давно не работали; эмигранты, уехавшие в США за счастьем.

По разным причинам человек выпадает из своего обычного окружения и не может присоединиться к новой группе.Маргинальные люди испытывают стресс, психологический стресс, переживают кризис идентичности. Также им свойственны враждебное отношение к окружающим, повышенная чувствительность и нереализованные амбиции.

Примеры такого состояния часто встречаются в России. Сложная ситуация в стране привела к падению доходов и росту безработицы. Человек вынужден менять место работы, при этом меняется и его социальный статус. Допустим, он работал в науке, а теперь вынужден резко сменить сферу деятельности, в которой испытывает дискомфорт.


В Европе количество маргинализированных людей увеличивается. Общество не принимает этих людей, в результате чего они не могут общаться и даже организовывать беспорядки.

Признаки маргинальности:

  • разрыв экономических, социальных и духовных связей «предмаргинальной» жизни;
  • мобильность, возникающая при отсутствии корпуса, навесного оборудования;
  • психические проблемы, возникающие из-за невозможности найти «место под солнцем»;
  • развитие собственных ценностей, иногда враждебность существующему обществу;
  • участие в незаконной деятельности.

Типы маргиналов

Выделяют маргинализованных по политическим, этническим, религиозным, социальным, экономическим и биологическим причинам.

Политические маргиналы — это люди, которых не устраивает политический режим в стране, законы. Часто они становятся беженцами или эмигрантами. Есть много политических маргиналов на Кубе, в Сирии, Турции и других странах.


Этнические маргиналы происходят от межэтнических браков. В результате человек не соотносит себя ни с какой национальностью своих родителей — в этом случае его никуда не принимают.Также этнические маргиналы — это национальные меньшинства, представители крайне малых этнических групп, проживающие среди других национальностей.

Они не являются представителями какой-либо существующей религии и не считают себя фиктивными конфессиями: например, «Церкви Бэкона». Среди таких маргиналов есть лжепророки, которые создают свои собственные религиозные движения.


Социальные маргиналы теряют привычное место и не могут найти его в другом обществе. Они появляются в нестабильном состоянии общества, революциях, катаклизмах.Например, в России после революции 1917 года представители дворянства стали маргиналами.

Экономические маргиналы — это либо очень бедные, либо очень богатые люди. Оба отрезаны от общества. Первые не могут позволить себе элементарные вещи, экономя на самом необходимом, вторые купаются в роскоши, не замечая проблем.


Биологические маргиналы попадают в эту категорию в результате болезни, возраста, врожденных дефектов. Общество не готово принять ВИЧ-инфицированных, инвалидов, неизлечимо больных, ставших изгоями.

Маргинальность бывает естественная и искусственная … В обществе есть «дно» в виде разоренных и деградированных людей, а также антисоциальные элементы — те, кого отвергает само общество.


Пример массовой искусственной маргинализации — в середине прошлого века, осуществленной фашистской Германией. Искусственная маргинализация приобрела катастрофические масштабы в эпоху сталинизма. Члены семей «врагов народа», спецпоселенцев и др.стали маргинализованными.

Синонимы

Слова и выражения, близкие по значению: «урод», «деклассированный элемент», «нигилист», «изгой», «неформальный».

Понятия «люмпен» и «маргинальный» не являются полными синонимами, хотя и похожи. Разница оттенков значений. Люмпен — человек, который «отбился от своего народа» и перестал работать. Они бродяги, нищие, нищие. Маргиналы, которые уволились или потеряли работу, стали люмпенами.


При благоприятном развитии событий период маргинальности у человека длится недолго: он адаптируется, присоединяется к обществу, находит работу, друзей и перестает быть маргинальным.Однако этот «статус» может быть навязан человеку обществом из-за его уникальности, неповторимости, непохожести или болезни. Такое «клеймо» ставят в школах, трудовых коллективах, даже в семье. Кто-то опускается на социальное дно и больше не может выбраться, а кто-то решает не возвращаться к «нормальной», обычной жизни и гордо носит титул «маргинализованный».

Слово «маргинальный» пришло в русский язык из немецкого, там — из французского, а в свою очередь из. С латинского языка это слово можно перевести как «на краю».«Изгои — это изгои, оказавшиеся вне своей социальной группы или на стыке двух разных групп. Если речь идет об одном человеке, скорее всего, он был исключен из одной группы и не принят в другую. Брайт — люди, которых заставили покинули свою страну и оказались отступниками в глазах ее граждан, но при этом не смогли принять традиции другого государства, в которое они переехали.

Такое социально пограничное состояние воспринимается очень тяжело. про группу людей, скорее всего, суть в серьезных социальных, политических, экономических изменениях в обществе, которые привели к распаду привычного общества.Нечто подобное часто случается в результате революций.

Слово «люмпен» снова заимствовано из немецкого языка, и в переводе это «тряпки». Люмпенами называют людей, которые находятся в низших социальных слоях и при этом не занимаются какой-либо общественно полезной работой. Это то, что нельзя назвать таким бедным человеком, который в поте лица пытается зарабатывать деньги, но добивается весьма скромных результатов. Вовсе нет — речь идет о преступниках, бродягах, нищих, тех, кто занимается пиратством и грабежом.

Очень часто неработающих алкоголиков и наркоманов также считают люмпенами, людьми, которых кто-то поддерживает, хотя они вполне могут работать и зарабатывать деньги. Также называются представители низшего социального слоя, живущие за счет государственных пособий.

Чем отличается люмпен от маргинала

Как правило, люмпены почти не имеют собственности: они либо кочуют, либо живут в чужих домах, а имеют только самое необходимое для жизни. Маргинальные люди, напротив, могут быть даже состоятельными людьми, которые при этом не признаются обществом, так как по каким-то причинам утратили прежнее положение.

Люмпены либо используют короткие, разовые заработки, либо зарабатывают деньги нелегально, либо живут за счет близких или государства. Маргинальные люди могут заниматься общественно полезным трудом.

Дополнительное значение термина «люмпен» — это человек, не имеющий собственных моральных устоев, не подчиняющийся законам морали и безрассудно или трусливо подчиняющийся группе людей, обладающих наибольшей властью в конкретный исторический момент. . Маргиналы в таких случаях становятся жертвами, а не бездумно действующей силой.

Источники:

В каждом обществе бок о бок с социально адаптированными гражданами есть люди, утратившие социальные корни, которым чужд моральный кодекс, они понимают только язык грубой физической силы.

Люмпен

Обычно к люмпенам относятся люди, не имеющие социальных корней, не имеющие к тому же собственности и живущие за счет единовременного заработка. Но чаще всего их источником существования являются различные виды социальных и государственных пособий.В целом в эту категорию должны входить бездомные, а также им подобные. Проще говоря, люмпен — это человек, который не занимается трудовой деятельностью, он нищий, скитается, то есть бездомный.

В переводе с немецкого слово «люмпен» означает «тряпки». Они своего рода оборванцы, опустившиеся на «дно» жизни, выпавшие из своей среды. Чем больше люмпенов становится в обществе, тем большую опасность они представляют для общества. Их окружение является своего рода оплотом для различных экстремистски настроенных лиц и организаций.Марксистская теория даже использовала такое выражение, как «Люмпенский пролетариат», описывая этим словом бродяг, преступников, нищих, а также отбросы человеческого общества в целом. При советской власти это было ругательство.

Маргиналы и люмпены — это не одно и то же, хотя у этих групп людей много общего. Само понятие «маргинальность» в социологии означает человека, находящегося между двумя разными социальными группами, когда гражданин уже отделился от одной из них и еще не прижался ко второй.Это так называемые яркие представители низшего сословия или социального «дна». Такое социальное положение очень сильно влияет на психику, калечит ее. Часто люди, прошедшие войну, иммигранты, которые не смогли адаптироваться к условиям жизни на своей новой родине, которые не смогли вписаться в социальные условия их современной среды, становятся маргинализированными.

Во время коллективизации, проводившейся в СССР в 1920-х и 1930-х годах, сельские жители массово мигрировали в города, но городская среда не хотела их принимать, и все корни и связи с сельской средой были разорваны.Их духовные ценности рушились, налаженные общественные связи порваны. И именно этим слоям населения нужна была «твердая рука», устоявшийся порядок на государственном уровне, и именно это послужило социальной основой антидемократического режима.

Как видите, люмпен и маргиналы — не тождественные понятия, хотя у них много общего. В современной действительности слово «люмпен» практически не употребляется, называя бездомных маргиналами.Хотя этим словом можно описать и людей, имеющих жилье, но ведущих асоциальный образ жизни.

Источники:

В современной культуре встречаются не только отдельные личности, но даже целые группы людей, не вписывающиеся в сложившуюся социальную структуру общества. Это не всегда представители социального «дна», они могут иметь высокий уровень образования и соответствующий статус. Отличие таких маргиналов от других людей — в особом мире ценностей.Кто такие маргиналы?

Маргинализация как социальное явление

Википедия называет маргиналом, оказавшимся на границе противоположных социальных групп или культур. Такие люди испытывают взаимное влияние различных систем ценностей, которые часто противоречат друг другу. Временами синонимом «маргинального» было «деклассированный элемент». Так часто называли людей, скатившихся до самых низов социальной иерархии. Но понимание маргинальности следует считать односторонним и не совсем правильным.

Понятие «маргинальность» также встречается. Здесь оно обозначает промежуточность того социального положения, в котором оно находится. Первые упоминания о маргинальных индивидах и группах появились в американской социологии, описывающей адаптацию иммигрантов к необычным для них социальным условиям и порядкам, присущим жизни на чужбине.

Маргиналы отрицают ценности группы, из которой они вышли, и отстаивают новые нормы и правила поведения.

За гранью вашей обычной жизни

Маргинализация общества усиливается, когда начинаются катаклизмы. Если общество регулярно лихорадит, его структура теряет свою силу. Возникают совершенно новые социальные группы и слои населения со своим укладом жизни. Не каждый человек в таких условиях способен адаптироваться и придерживаться определенного берега.

Переход в новую социальную группу часто связан с необходимостью перестроить поведение и принять новую систему ценностей, что почти всегда становится источником стресса.

Выйдя из обычного социального окружения, человек часто сталкивается с ситуацией, когда новая группа его не принимает. Так появляются маргиналы. Вот один из примеров такого социального перехода. Средний инженер, который бросает работу и решает заняться бизнесом, терпит неудачу. Он понимает, что бизнесменом не оказался, и вернуться к прежнему образу жизни уже невозможно. К этому можно добавить финансовые и другие материальные потери, в результате которых человек оказывается вне жизни.

Но маргинальность не всегда связана с потерей достаточно высокого бывшего соц. Довольно часто к маргиналам относятся вполне успешные люди, взгляды, привычки и система ценностей которых не укладываются в устоявшиеся представления о «нормальности». Маргинальные люди вполне могут быть достаточно обеспеченными людьми, добившимися успехов в своей сфере деятельности. Но их взгляды на жизнь оказываются настолько необычными для рядового обывателя, что таких людей просто не принимают всерьез или вытесняют из социального сообщества.

Видео по теме

Понятие маргинальности — это социологический термин, появившийся в науке в 1920-х годах. Но сами маргиналы — люди, составляющие особую социальную группу — существовали задолго до того, как ученые ввели этот термин. Это люди, которые по каким-то причинам не вписались в социокультурную систему общества. Большие группы маргиналов начали формироваться в начале 20 века. Но, наверное, первые маргиналы появились еще в первобытную эпоху.

Термин «маргинальность» был введен американскими социологами для характеристики наблюдаемого ими социального феномена: создания иммигрантами закрытых сообществ из-за их неспособности сразу вписаться в американский образ жизни. Для нового термина было выбрано латинское слово marginalis, что означает «на краю». Таким образом, иммигрантские сообщества характеризовались как группы, вырванные из родного культурного слоя и не укоренившиеся на новой почве.

Маргинальная группа характеризуется своей особой культурой, которая часто вступает в конфликт с доминирующими культурными установками в обществе.Типичный пример — итальянская мафия в Америке. Дон Корлеоне и его семья маргинализированы в американском обществе.

Итак, в строгом социальном смысле первые маргиналы появились в конце 19 — начале 20 веков в кипящем котле американской иммиграции. Это были люди двух культур, одновременно принадлежавшие к двум мирам. Не только в США, конечно, наблюдались подобные явления: например, Бразилия примерно в то же время приглашала на плантации итальянских иммигрантов, которые не сразу вписывались в существующее общество наравне с потомками португальцев, и часто воспринимались как «белые».

Маргинальные группы также могут возникать в результате серьезных социальных потрясений. Например, революция в России привела к появлению большого количества маргинализированных людей — людей, вырванных из рамок своего класса и с трудом находящих себе место в новом обществе. Например, беспризорные дети 1920-х годов — типичная маргинальная группа.

Постепенно понятие маргинальности в науке расширилось. Появилось понятие «индивидуальная маргинальность».Это шире, чем маргинальность как социальное явление. И.В. Малышев в своей книге «Маргинальное искусство» характеризует маргинальность как «внесистемную». Люди, хранящие прошлое, могут оказаться в изоляции; опережая свое время; просто «заблудились» и не нашли себе места в обществе и его культуре.

В этом смысле по Виктору Шендеровичу маргиналами можно назвать Сахарова, Томаса Манна и даже Христа.

Итак, первые маргиналы, скорее всего, появились на заре человечества.Возможно, первые homosapiens были просто маргинализированы!

Поскольку общество опасается маргиналов, жизнь «несистемных» людей на протяжении всей истории человечества была трудной и, увы, обычно короткой. Некоторые из них стали социальными люмпенами, изгоями-изгоями, но многим удалось продвинуть культуру вперед, наметить новые ориентиры для развития общества.

Возмутительные художники, например, часто оказывались в маргинальном положении. Они смело отказались от традиционных ценностей и создали свои.Например, Диоген был маргиналом. Декаденты оказались на обочине. Советские парни были маргиналами.

В конце ХХ — начале ХХI веков маргиналов было намного больше, чем в любую другую историческую эпоху. Различные неформальные движения, как правило, маргинализированы. Толерантность современного общества позволяет представителям маргинальных слоев жить в собственной системе координат более свободно, чем раньше.

Кто такие маргиналы, в каком смысле допустимо употреблять этот термин — об этом в нашей статье.

Понятие маргинальности довольно распространено, но его можно интерпретировать по-разному, часто неся негативный оттенок.

Маргинальное: определение

  • Маргинал — это человек, мировоззрение, принципы и образ жизни которого не соответствуют принятым в обществе порядкам и нормам.
  • Маргиналами также называют людей, которые по тем или иным причинам утратили свои социальные функции — они отрицают законы культуры, религии, морали своей нации, страны или сообщества, но при этом не придерживаются других социальных группы, находящиеся вне классов и объединений людей.
  • Наряду с этим определением, в наше время «маргинальная личность» — модное понятие, затрагивающее представление о свободе и независимости, о человеке, находящемся вне системы, вне законов, налагаемых существующей социальной структурой.

Термин «маргинальный» происходит от латинского «margo», что означает край. Первоначально слово «маргиналия» означало рукописные заметки на полях книг, связанные с содержанием. В 1928 году американский социолог Р. Парк ввел этот термин для описания поведения человека вне существующих социальных групп.

Маргинальные люди — это люди, избегающие социальных контактов

Определение слова маргинальный в толковом словаре

В социологии: потерявший старые социальные нормы поведения и не приспособившийся к новым условиям жизни (обычно это представители национальных меньшинств, мигранты, люди из сельской местности). В общем смысле: тот, кто не признает общепринятые моральные нормы и правила поведения.

Маргинальное: значение слова простыми словами

  • В 30-е годы прошлого века сельские жители, приехавшие в большие города на заработки, но не устроившиеся, эмигранты, не сумевшие прижиться на новой родине, а также люди, оставшиеся без работы и крыши над головой. над их головами были названы изгоями.Позже термин получил более широкое значение.
  • Маргиналы — это люди, утратившие связь с обществом, в котором они живут. Маргиналов не следует воспринимать как людей второго сорта. Просто их поведение заметно отличается от стабильного большинства, принятых традиций и устоев.


В словаре можно найти общее определение термина «маргинальный»

Слово маргинальное: примеры использования

В современном русском языке слово маргинальный имеет следующие синонимы: неформальный, изгой, индивидуальный.Вот несколько цитат из употребления слова маргинальный в литературе:

Любая часть нашего общества устроена таким образом, что массы и маргиналы в нем распределяют обязанности между собой и дополняют друг друга. Вера в чудо в повседневной жизни оказывается оправданной и многообещающей, чем неверие, загоняющее человека на обочину, в пьянство, в наркотики.

Кто такие маргиналы?

Некоторые современные психологи и социологи считают, что маргинальный тип личности более интеллектуален и развит, открыт для изменений, не зависит от ограничивающих факторов и двойных стандартов общества.К маргиналам относятся совершенно разные люди с непохожей жизненной ситуацией, которые в силу сложившихся обстоятельств становятся изгоями общества:

  • Люди с ограниченными физическими возможностями.
  • Люди с психическими заболеваниями.
  • Представители нетрадиционных религиозных движений и сект.
  • Отшельники, сознательно противопоставляющие свои убеждения нормам общественного мнения.
  • Люди, оказавшиеся за чертой бедности, которые, в то же время, не стремятся улучшить свое положение.
  • Люди, занимающиеся преступной деятельностью.

Отличительные черты характера маргиналов:

  • Негативное отношение к другим
  • Избегание социальных контактов и желание конфиденциальности
  • Эгоцентризм
  • Неудовлетворенные амбиции
  • Беспокойство и фобии


Внешний вид маргиналов часто отличается от принятых норм.

Виды маргиналов

Среди всех типов социальных изгоев можно выделить 4 основные группы маргинализированных людей:

Экономичный

Этот вид маргинальности зависит от изменений в материальной сфере — потери работы, привычных источников дохода, денежных сбережений или собственности.Все эти факторы приводят к переоценке ценностей, поиску новых способов заработка, а часто — к гневу и отказу от привычного круга общения. Самый сложный тип экономической маргинальности — это падение самооценки из-за неспособности улучшить благосостояние, алкоголизм, наркомания и разрушение личности.

Социальные сети

Социальная маргинальность связана со стремлением достичь более высокого социального статуса, попасть в другую социальную группу — переход на более престижную работу или высокооплачиваемую должность, выгодный брак.Если такое улучшение социального статуса длится недолго или заканчивается неудачей, человек теряет контакт с предыдущим окружением и оказывается в положении изгоя.

Политические

Политическая маргинальность проявляется на фоне политических кризисов, недоверия к власти и упадка гражданского сознания. Такие люди сознательно противопоставляют себя обществу с существующей политической системой, противостоят общественному мнению, нормам и законам.

Этническое происхождение

К этому типу относятся люди, которые по тем или иным причинам сменили место жительства и оказались среди представителей другой национальности или этноса.В таких случаях, помимо языкового барьера, мигранты испытывают трудности с восприятием чужой культуры и традиций. Особенно ярко это проявляется в тех случаях, когда новая среда существенно отличается от привычной — религия, образ жизни, особенности менталитета. Этническую маргинальность преодолеть труднее всего, потому что она основана на факторах, которые человек не может изменить — внешности, религиозной принадлежности, обычаях и традициях.


Принудительная маргинальность связана с исключением себя из существующего общества

Видео: Кто такие маргиналы?

Маргинализованные люди — это люди, которые по разным причинам бросили то, к чему они привыкли, и не могут присоединиться к новым социальным слоям, обычно из-за культурных несоответствий.В такой ситуации они испытывают сильный психологический стресс и переживают кризис самосознания.

Теория о том, кто такие маргиналы, была выдвинута еще в первой половине 20 века Р.Э. Парк, но до него вопросы социальной рассекречивания поднимал Карл Маркс.

Теория Вебера

Вебер пришел к выводу, что социальное движение начинается, когда маргинальные слои создают сообщество, и это приводит к различным реформам и революциям. Вебер дал более глубокую интерпретацию того, что позволило объяснить формирование новых сообществ, которые, конечно, не всегда объединяли социальные отходы общества: беженцев, безработных и так далее.Но с другой стороны, социологи никогда не опровергали неоспоримой связи между человеческими массами, исключенными из системы привычных социальных связей, и процессом организации новых сообществ.

В сообществах людей действует главный принцип: «Хаос надо как-то упорядочить». При этом новые классы, группы и слои практически не возникают в связи с организованной активной деятельностью нищих и бомжей. Скорее, это можно рассматривать как построение параллельных людей, жизнь которых до перехода на новую должность была вполне упорядоченной.

Несмотря на преобладание модного сейчас слова «маргинальный», само понятие довольно расплывчатое. Следовательно, невозможно конкретно обозначить роль этого явления в культуре общества. На вопрос о том, кто такие маргиналы, можно ответить по характеристике «несистемность». Это будет наиболее точное определение. Потому что маргиналы находятся вне социальной структуры. То есть они не принадлежат ни к какой группе, определяющей характер общества в целом.

В культуре тоже есть маргиналы. Здесь они находятся вне основных типов мышления и языка и не относятся ни к какому художественному направлению. Маргиналов нельзя причислить к какой-либо доминирующей или основной группе, оппозиции или различным субкультурам.

Общество давно определило, кто такие маргинализированные. Установлено мнение, что это представители низших слоев общества. В лучшем случае это люди вне рамок норм и традиций. Как правило, называть человека маргиналом свидетельствует о негативном, пренебрежительном отношении к нему.

Но маргинальность — это не автономное состояние, это результат отказа от норм и правил, выражение особых отношений с существующим. Она может развиваться в двух направлениях: разрыв всех привычных связей и создание своих. собственный мир, либо постепенное вытеснение обществом с последующим выходом за рамки закона. В любом случае маргинальное — это не изнанка мира, а только его теневые стороны. Общественность привыкла выставлять напоказ людей за пределами системы, чтобы создать свой собственный, считающийся нормальным миром.

Роль и механизм трансформации фактора роста бета 3 в индуцированном инфарктом миокарда фиброзе миокарда

J Cell Mol Med. 2019 июн; 23 (6): 4229–4243.

, 1 , 1 , 1 , 1 , 1 , 1 , 1 , 1 , 1 и 1

Кэ Сюэ

1 Кафедра патологии и судебной медицины, Колледж фундаментальных медицинских наук, Даляньский медицинский университет, Далянь, Китай,

Цзюнь Чжан

1 Кафедра патологии и судебной медицины, Колледж фундаментальных медицинских наук, Даляньский медицинский университет, Далянь, Китай,

Конг Ли

1 Кафедра патологии и судебной медицины, Колледж фундаментальных медицинских наук, Даляньский медицинский университет, Далянь, Китай,

Цзин Ли

1 Кафедра патологии и судебной медицины, Колледж фундаментальных медицинских наук, Даляньский медицинский университет, Далянь, Китай,

Конг Ван

1 Кафедра патологии и судебной медицины, Колледж фундаментальных медицинских наук, Даляньский медицинский университет, Далянь, Китай,

Цинцин Чжан

1 Кафедра патологии и судебной медицины, Колледж фундаментальных медицинских наук, Даляньский медицинский университет, Далянь, Китай,

Сяньлу Чен

1 Кафедра патологии и судебной медицины, Колледж фундаментальных медицинских наук, Даляньский медицинский университет, Далянь, Китай,

Сяотан Юй

1 Кафедра патологии и судебной медицины, Колледж фундаментальных медицинских наук, Даляньский медицинский университет, Далянь, Китай,

Лей Вс

1 Кафедра патологии и судебной медицины, Колледж фундаментальных медицинских наук, Даляньский медицинский университет, Далянь, Китай,

Сяо Юй

1 Кафедра патологии и судебной медицины, Колледж фундаментальных медицинских наук, Даляньский медицинский университет, Далянь, Китай,

1 Кафедра патологии и судебной медицины, Колледж фундаментальных медицинских наук, Даляньский медицинский университет, Далянь, Китай,

Автор, ответственный за переписку. * Переписка
Лэй Сун и Сяо Ю, кафедра патологии и судебной медицины, Колледж фундаментальных медицинских наук, Даляньский медицинский университет, Далянь, Ляонин, Китай.
Электронная почта: [email protected] и [email protected],

Получено 3 октября 2018 г .; Пересмотрено 11 февраля 2019 г .; Принято 4 марта 2019 г.

Авторские права © 2019 Авторы. Журнал клеточной и молекулярной медицины, опубликованный John Wiley & Sons Ltd и Фондом клеточной и молекулярной медицины.Это статья в открытом доступе в соответствии с условиями http://creativecommons.org/licenses/by/4.0/ лицензии, которая разрешает использование, распространение и воспроизведение на любом носителе при условии правильного цитирования оригинальной работы. цитируется другими статьями в PMC.

Abstract

Трансформирующий фактор роста бета (TGFβ) играет решающую роль в фиброзе тканей. Ряд исследований показал, что TGFβ3 значительно ослабляет фиброз тканей. Однако механизм этого эффекта плохо изучен.В этом исследовании мы обнаружили, что уровень экспрессии TGFβ3 был выше в тканях инфаркта миокарда (ИМ) человека, чем в нормальных тканях, и, что интересно, он увеличивался с развитием фиброза после инфаркта миокарда (пост-ИМ). In vitro сердечные фибробласты человека (CF) инкубировали с ангиотензином II (Ang II) для имитации микроокружения ишемического миокарда и использовали для исследования антифиброзного механизма TGFβ3. Затем белки, связанные с фиброзом, были обнаружены с помощью вестерн-блоттинга.Было обнаружено, что повышающая регуляция TGFβ3 ослабляет пролиферацию, миграцию CF человека и экспрессию коллагенов, которые являются основными факторами фиброза, способствуют сдвигу фенотипа и перекрестному связыванию коллагенов. Важно, что экспрессия коллагенов была выше в группах si-smad7, чем в контрольных группах, тогда как подавление smad7 увеличивало уровень фосфорилирования сигнального пути TGFβ / smad. В совокупности эти результаты показали, что TGFβ3 ингибирует фиброз через сигнальный путь TGFβ / smad, возможно, связанный с регуляцией smad7, и что TGFβ3 может служить потенциальной терапевтической мишенью для фиброза миокарда после ИМ.

Ключевые слова: сердечные фибробласты, фиброз миокарда, инфаркт миокарда, smad7, TGFβ3

1. ВВЕДЕНИЕ

Ремоделирование миокарда после инфаркта миокарда (ИМ) является основным фактором, ускоряющим сердечную недостаточность. В ИМ вовлечены несколько патофизиологических процессов, включая воспаление, апоптоз клеток, ангиогенез, гипертрофию, синтез и отложение внеклеточного матрикса (ВКМ) и перекрестное связывание коллагенов.2 Чрезмерное отложение ВКМ приводит к сердечному фиброзу, что приводит к ослаблению податливости желудочков, сердечной недостаточности. дисфункция и в конечном итоге сердечная недостаточность.3 Критическая фаза этих ответов зависит от изменения микросреды сердца, которое включает изменения воспаления, пролиферацию и миграцию немиоцитов.

Сердечные фибробласты (CF) играют решающую роль в поддержании нормальной сердечной функции и в ремоделировании сердца во время патологических состояний, таких как инфаркт миокарда и гипертония. Эти клетки выполняют множество функций, включая синтез и отложение ECM, межклеточную связь с миоцитами и передачу сигналов между клетками с другими фибробластами и эндотелиальными клетками.На ранней стадии инфаркта миокарда CF, характеризующиеся их фундаментальным вкладом в сердечную реакцию на различные формы повреждения, накапливаются в области инфаркта в ответ на набор цитокинов.5 В фазе созревания CF секретируют коллагены и другие белки ECM для поддерживать стабильность рубца.6 Фенотип МВ меняется на фенотип миофибробластов. Таким образом, регулирование синтеза, отложения и перекрестного связывания коллагенов является ключевым шагом в улучшении прогноза после инфаркта миокарда.

Трансформирующий фактор роста бета (TGFβ), суперсемейство многофункциональных пептидов, регулирует рост, дифференцировку клеток и влияет на действие клеточных рецепторов.7 Из человеческих источников были выделены только изоформы TGFβ1, TGFβ2 и TGFβ3.8 Ряд исследований показал, что это суперсемейство влияет на различные биологические процессы при фиброзе тканей, 7 из которых TGFβ1 и TGFβ2 рассматривались как критические молекулярные факторы, определяющие формирование фиброза, сопровождающего многие болезненные состояния; тем не менее, TGFβ3 подавляет рубцевание и фиброз in vivo в определенных экспериментальных условиях.

Экспрессия TGFβ3, которая высока в микроокружении эмбриональной раны, 10 преимущественно и постоянно увеличивалась в пораженных инфарктом областях у крыс.11 Таким образом, TGFβ3 оказался очень многообещающим кандидатом для прогноза ИМ. Однако патологическая роль TGFβ3 в фиброзе после инфаркта миокарда и молекулярные механизмы, лежащие в основе пролиферации, миграции, изменения фенотипа и функции миокардиальных фибробластов, остаются плохо изученными.7 Многие клинические данные показали, что ангиотензин II (Ang II) играет важную роль в ремоделировании миокарда. после MI.12 уровни 13 Cardiac Ang II быстро повышались после травмы, что стимулировало пролиферацию, миграцию, изменение фенотипа и синтез коллагена в CFs.14 Кандесартанан, блокатор рецепторов Ang II AT1, привел к усилению экспрессии TGFβ3 в кортикальных и гиппокампальных астроцитах у мышей.15 Учитывая потенциальную антифиброзную роль TGFβ3 в контексте восстановления и ремоделирования тканей, а также известно участие Ang II в активации фибробластов и отложении матрикса, мы предположили, что TGFβ3 может иметь определенные эффекты на индуцированный Ang II фиброз миокарда.

TGFβ выполняет свою биологическую функцию путем передачи сигнала smad.Белки Smad обычно состоят из двух доменов. Домен гомологии амино Mad (MH) 1 обладает способностью связываться с ДНК, в то время как карбоксильный домен Mh3, как было показано, опосредует взаимодействия с множеством белков. В ядре комплекс smad связывается с промоторами или энхансерами генов-мишеней TGFβ, чтобы индуцировать специфичные для клеток программы транскрипции.

В этом исследовании мы измерили уровни экспрессии TGFβ1, TGFβ2 и TGFβ3 в нормальных областях миокарда человека, областях MI и в образцах сыворотки.Впоследствии мы применили экзогенный и эндогенный TGFβ3 к CF человека, чтобы проанализировать эффекты TGFβ3 на пролиферацию, миграцию, изменение фенотипа, синтез коллагена и перекрестное связывание. Чтобы изучить возможный молекулярный механизм, с помощью которого TGFβ3 регулирует фиброзный потенциал, мы применили Ang II-индуцированную среду к CF человека и проанализировали относительные уровни синтеза коллагена, перекрестного связывания, молекул TGFβ / smad и их фосфорилирования. Наконец, мы исследовали роль smad7 в сигнальном пути TGFβ / smad.

2. МЕТОДЫ И МАТЕРИАЛЫ

2.1. Ткань и культура клеток

Контрольные образцы (n = 6), экспериментальные образцы ранней фазы ИМ (n = 6) и поздней фазы ИМ (n = 6), которые были получены из передней стенки левого желудочка вблизи верхушка сердца у пациентов с ИМ в возрасте от 30 до 70 лет и образцы их сыворотки были собраны в течение 48 часов после смерти отделением патологии и судебной медицины Даляньского медицинского университета. Все процедуры, касающиеся образцов человека, соответствовали принципам, изложенным в Хельсинкской декларации, и были одобрены Даляньским медицинским университетом.Материальное обеспечение было рассмотрено и одобрено Комитетом по институциональной этике. Человеческие CF (BIOLEAF) (пассажи 1-20) культивировали в культуральных колбах. После двукратной промывки бессывороточной средой клетки инкубировали с сывороткой, содержащей 10% модифицированную Дульбекко среду Игла / F12 (DMEM / F12), в увлажненном инкубаторе при 37 ° C и 5% CO 2 . Ang II (Proteintech), белок рекомбинантного трансформирующего фактора роста бета (rTGFβ3) (Proteintech) и другие реагенты для трансфекции (GenePharma) использовали для обработки клеток в соответствии с планом эксперимента.

2.2. Окрашивание гематоксилин-эозином (HE)

Ткани фиксировали 4% параформальдегидом, заливали парафином и делали поперечные срезы (4 мкм). Окрашивание HE было выполнено для различения нормальной ткани, ткани ранней фазы и поздней фазы MI в соответствии с инструкциями производителя (ZSGB-BIO). Некроз полосы сокращения и нейтрофильная инфильтрация выявляются в течение 3 дней после инфаркта. Через 10–14 дней после инфаркта миокарда отложение коллагена становится заметным.Повышенное отложение коллагена с пониженной клеточностью указывало на более чем 2 недели после ИМ.17 Мы сгруппировали случаи в течение 3 дней как раннюю фазу ИМ, а случаи, которые продолжались более 2 недель, как позднюю. Срезы наблюдали под оптическим микроскопом. Ткани были окрашены в розовый цвет для обозначения цитоплазмы и сине-фиолетовый для обозначения ядер клеток.

2.3. Окрашивание по Массону

Препараты из парафина (4 мкм) использовали при окрашивании по Массону, которое выполняли для различения нормальной ткани, ранней фазы и поздней фазы тканей ИМ в соответствии с инструкциями производителя (Solarbio).Шелкоподобные волокна указывают на раннюю фазу ИМ, а появление отложения коллагена указывает на позднюю фазу ИМ. Мышечные волокна казались красными, а волокна коллагена — синими.

2.4. Иммуногистохимическое окрашивание

Для обнаружения экспрессии и распределения TGFβ1 (1: 100; Proteintech), TGFβ2 (1: 100; Proteintech) и TGFβ3 (1: 100; Proteintech) слайды инфарктных тканей были иммуногистохимически окрашены соответствующими антителами. следуя инструкциям производителя (ZSGB ‐ BIO), результаты были качественно проанализированы статистически на парафиновых предметных стеклах (4 мкм).Слайды были количественно оценены путем случайного выбора пяти полей в области инфаркта из каждого раздела. Срезы наблюдали под оптическим микроскопом. TGFβ1, TGFβ2 и TGFβ3 визуализировались с помощью 3,3-диаминобензидина (DAB), хромогенного субстрата для пероксидазы. Коричнево-желтые ткани показали положительное окрашивание.

2,5. ELISA

ELISA выполняли на образцах сыворотки для измерения уровней TGFβ1 (Elabscience), TGFβ2 (Elabscience) и TGFβ3 (Elabscience) в соответствии с инструкциями производителя.Образцы сыворотки крови человека были получены при вскрытии. Все процедуры, касающиеся образцов человека, соответствовали принципам, изложенным в Хельсинкской декларации, и были одобрены Даляньским медицинским университетом. Материальное обеспечение было рассмотрено и одобрено Комитетом по институциональной этике.

2.6. Иммунофлуоресцентное окрашивание

Иммунофлуоресцентный анализ был проведен для определения экспрессии и распределения α-актина гладких мышц (α-SMA; 1: 200; Proteintech) и виментина (1: 200; Proteintech) в качестве контроля в CF человека для определения фенотипа. сдвиги в CF человека.Кроме того, иммунофлуоресцентное окрашивание с использованием антител рецептора дискоидинового домена 2 (DDR2; 1: 200; Proteintech) и фибробласт-специфического белка 1 (FSP-1; 1: 200; Proteintech) проводили для маркировки CF, а ядра контрастировали с 0,5. мкг / мл 4 ‘, 6-диамидино-2-фенилиндол (DAPI; Solarbio). Окрашивание анализировали с помощью иммунофлуоресцентного микроскопа (Olympus).

2.7. Анализ пролиферации клеток

CF человека высевали в 96-луночные планшеты с плотностью 2000 клеток / лунку, и пролиферацию оценивали с помощью анализа Cell Counting Kit-8 (CCK-8; Trans) в соответствии с экспериментальным предложением.В каждую лунку добавляли десять микролитров раствора CCK-8, и клетки инкубировали еще 2 часа в увлажненном инкубаторе. Оптическую плотность измеряли при 450 нм с использованием считывающего устройства для микропланшетов (Thermo Scientific). Для каждой группы создавали пять повторяющихся лунок и проводили три независимо повторяющихся эксперимента.

2,8. Анализ клеточной токсичности

Человеческие CF высевали в 96-луночные планшеты с плотностью 2000 клеток / лунку, и токсичность оценивали с помощью тестов MTT (Solarbio) в соответствии с экспериментальным предложением.В каждую лунку добавляли двадцать микролитров МТТ, и клетки инкубировали еще 4 часа в увлажненном инкубаторе. Кристаллы формазана солюбилизировали 20 мкл ДМСО, а затем измеряли оптическую плотность при 490, 570 и 630 нм с использованием считывающего устройства для микропланшетов (Thermo Scientific). Для каждой группы создавали пять повторяющихся лунок и проводили три независимо повторяющихся эксперимента.

2.9. Вестерн-блоттинг

Клетки лизировали, и белки в экстрактах супернатанта количественно определяли с использованием набора BCA Protein Assay Kit (Beyotime).Общие клеточные лизаты, содержащие 50 мкг белка, разделяли с помощью электрофореза в додецилсульфат-полиакриламидном геле (SDS-PAGE) и переносили на нитроцеллюлозные (NC) мембраны (PALL). После блокирования 5% обезжиренным сухим молоком в трис-буферном физиологическом растворе-Твин-20 (TBST) в течение 2 часов мембраны инкубировали с первичными антителами [антителом к ​​глицеральдегид-3-фосфатдегидрогеназе (GAPDH), разведенным в соотношении 1: 3000. ; коллаген I, коллаген III, лизилоксидаза (LOX), остеопонтин (OPN), виментин, α-SMA, smad2, p-smad2, smad3, p-smad3, smad4, smad7 и антитела p-smad7 в разведении 1: 2000 или 1 : 1000] при 4 ° C в течение ночи.Коллаген I, коллаген III, p-smad2, p-smad3 и p-smad7 антитела были приобретены у Abcam, а антитела GAPDH, β-tubulin, smad2, smad3, smad4, smad7, LOX, OPN, виментин и α-SMA были приобретены у Proteintech. После трех промывок TBST мембраны инкубировали с соответствующим вторичным антителом, конъюгированным с пероксидом хрена (HRP) (1: 5000, GE, HyClone), при 37 ° C в течение 2 часов. Полосы белка визуализировали с помощью усиленной хемилюминесценции (ECL; Advansta) и детектировали с помощью системы визуализации ChemiDoc TM MP (BIO-RAD).Затем полосы белка сканировали с использованием программного обеспечения Image Lab TM версии 4.1.

2.10. Трансфекция клеток

полноразмерная плазмида TGFβ3 (pEX4-TGFβ3), малая интерферирующая РНК TGFβ3 (siRNA-TGFβ3-homo-1423), малая интерферирующая РНК smad7 (siRNA-smad7-homo-1426) и не направленная последовательность (отрицательный контроль , NC) были синтезированы GenePharma. Последовательности миРНК показаны в таблице. Клетки высевали в шестилуночные планшеты (Corning) до тех пор, пока их плотность роста не достигала 50-70%, а затем трансфицировали реагентом липофектамин 2000 (Thermo Scientific) и указанной миРНК или плазмидой сывороткой- бесплатный DMEM / F12.После 6 часов инкубации среду заменяли средой DMEM / F12 с 10% фетальной телячьей сывороткой (FBS). Общее время анализов пролиферации и миграции составляло 24 часа, в течение которых клетки высевали в 96-луночные планшеты еще на 18 часов спустя. Сверхэкспрессию и эффективность подавления сигнала анализировали с помощью обратной транскрипции и количественной полимеразной цепной реакции (RT-qPCR) через 24 часа после трансфекции и анализа вестерн-блоттингом через 48 часов после трансфекции.

Таблица 1

последовательностей миРНК, использованных в исследовании

Гены Последовательность праймеров
si ‐ TGFβ3 Нападающий : GGAAUACUAUGCCAAAGAATT
Реверс : UUCUUUGGCAUAGUAUUCCTT
si ‐ smad7 Нападающий : CCAAUGACCACGAGUUUAUTT
Реверс : AUAAACUCGUGGUCAUUGGTT
Si ‐ NC Нападающий : UUCUCCGAACGUGUCACGUTT
Реверс : ACGUGACACGUUCGGAGAATT

2.11.

2.12. Анализ миграции клеток

Миграцию CF человека in vitro анализировали с использованием камеры трансвелл с поликарбоновой мембраной (диаметр 6,5 мм и размер пор 8 мкм; Corning). Человеческие CF были трипсинизированы и повторно суспендированы в бессывороточной среде при плотности 5 × 10 4 клеток / мл. Двести микролитров суспензии нетрансфицированных или трансфицированных клеток добавляли в верхнюю камеру и 600 мкл бессывороточной среды DMEM / F12 с добавлением различных концентраций TGFβ3 (0, 5, 10 или 50 нг / мл) или Ang II. 100 нмоль / л добавляли в нижнюю камеру в соответствии с требованиями эксперимента.Немигрирующие клетки с верхней поверхности мембраны удаляли ватными тампонами. Клетки, которые мигрировали к нижней поверхности мембраны, фиксировали 4% метанолом и окрашивали 10% Гимза (Solarbio). Количество клеток измерялось в пяти случайно выбранных полях при 200-кратном увеличении, а среднее количество рассчитывалось с помощью ImageJ.

2.13. RT ‐ qPCR

Тотальную РНК экстрагировали из культивированных CF человека с помощью реагента Trizol (Thermo Scientific). Концентрация и качество РНК определялись в соответствии с соотношением 260/280 нм, измеренным с помощью спектрофотометра NanoDrop (ND-100, Thermo Scientific).Общая кДНК была синтезирована с помощью TransScript One-Step gDNA Removal и cDNA Synthesis SuperMix (Trans). Экспрессию мРНК целевых генов количественно оценивали с помощью RT-qPCR с использованием TransStart Top Green qPCR SuperMix (Trans). Ген домашнего хозяйства GAPDH использовали в качестве контроля для smad7 и TGFβ3. Количество относительной экспрессии рассчитывали по 2 — △△ Ct . Последовательности праймеров, используемых в RT-qPCR, перечислены в таблице.

Таблица 2

Последовательности праймеров, использованные в исследовании

Гены Последовательность праймеров
TGFβ3 Нападающий : TGCGCCCCCTCTACATTG
Обратный : GGTTCGTGGACCCATTTCC
Smad7 Нападающий : TGCCTTCCTCCGCTGAAAC
Обратный : CACAGTAGAGCCTCCCCACTCT
GAPDH Нападающий : GTGGAAGGACTCATGACCACAGT
Реверс : GGAAGGCCATGCCAGTGA

2.14. Статистический анализ

Результаты выражены как среднее значение ± стандартная ошибка (SEM). Межгрупповые сравнения проводились с использованием одностороннего дисперсионного анализа результатов по крайней мере трех независимых экспериментов. Различия считались статистически значимыми, когда P <0,05. Все статистические анализы были выполнены с использованием статистического программного обеспечения GraphPad 5.0 (IBM).

3. РЕЗУЛЬТАТЫ

3.1. Образцы MI человека показали более высокие уровни TGFβ3, чем нормальные образцы

Мы оценили экспрессию TGFβ1, TGFβ2 и TGFβ3 в образцах MI человека и нормальных образцах.Окрашивание НЕ и Массона было выполнено для группировки ранней и поздней фаз ИМ (Рисунок S1). Окрашивание HE показало область инфаркта, а окрашивание по Массону показало, что количество коллагеновых волокон увеличивалось с развитием фиброза (Рисунок A). Иммуногистохимическое окрашивание на TGFβ1, TGFβ2 и TGFβ3 было количественно проанализировано (Рисунок A). Как было определено с помощью вестерн-блоттинга и ELISA, относительно высокая экспрессия TGFβ1 и TGFβ2 была обнаружена на ранней стадии ИМ, тогда как экспрессия TGFβ1 и TGFβ2 снижалась со временем инфаркта.Интересно, что уровень TGFβ3 постепенно увеличивался со временем инфаркта и достигал пика примерно через месяц после ИМ, что отличалось от TGFβ1 и TGFβ2, показывая отчетливое влияние TGFβ3 на развитие фиброза после ИМ (рисунок B-D).

A, Окрашивание НЕ показало, что коагуляционный некроз кардиомиоцитов указывает на раннюю фазу ИМ, а появление коллагенов указывает на позднюю фазу ИМ. При окрашивании по Массону шелкоподобные волокна указывали на раннюю фазу ИМ, а появление коллагеновых волокон указывало на позднюю фазу ИМ.Иммуногистохимическое окрашивание показало качественный анализ TGFβ1, TGFβ2 и TGFβ3 в нормальных тканях и тканях после инфаркта миокарда (n = 6, каждая группа). B, C, уровни экспрессии TGFβ1, TGFβ2 и TGFβ3 в ткани человека после инфаркта сердца по данным вестерн-блоттинга и полуколичественного анализа. Результаты показаны при использовании тубулина в качестве эндогенного контроля. Данные представлены как среднее значение ± стандартная ошибка среднего (n = 6, каждая группа). * P <0,05 по сравнению с нормальной группой; ** P <0,01 по сравнению с нормальной группой; *** P <0.005 по сравнению с нормальной группой; # P <0,05 по сравнению с ранней группой; ## P <0,01 по сравнению с ранней группой; ### P <0,005 по сравнению с ранней группой. Уровни экспрессии D, TGFβ1, TGFβ2 и TGFβ3 в сыворотке крови человека после инфаркта миокарда по данным ELISA. Данные представлены как среднее значение ± стандартная ошибка среднего (n = 6, каждая группа). * P <0,05 по сравнению с нормальной группой; ** P <0,01 по сравнению с нормальной группой; *** P <0,005 по сравнению с нормальной группой; # P <0.05 по сравнению с ранней группой; ## P <0,01 по сравнению с ранней группой; ### P <0,005 по сравнению с ранней группой

3.2. TGFβ3 изменяет биологическое поведение CF человека

Иммунофлуоресцентный анализ был проведен для подтверждения клеточной линии, в которой DDR2 и FSP-1 были высоко экспрессированы (Рисунок A). В этом исследовании для лечения CF человека в течение 24 часов использовались различные концентрации белка rTGFβ3 (0, 5, 10 и 50 нг / мл). Результаты показали, что по сравнению с контрольной группой TGFβ3 в концентрации 5 нг / мл значительно увеличивал скорость пролиферации и миграции CF человека и экспрессию коллагена Ⅰ и коллагена III в CF человека; кроме того, TGFβ3 в дозах 10 и 50 нг / мл значительно ослабляет скорость пролиферации и скорость миграции CF человека и ингибирует экспрессию коллагена Ⅰ и коллагена Ⅲ в CF человека ( P <0.05; Рисунок B, D-F). МТТ-анализ проводили для выявления цитотоксичности rTGFβ3, и значительного цитотоксического эффекта не наблюдалось (рис. C). Результаты вестерн-блоттинга показали, что TGFβ3 значительно увеличивал экспрессию LOX, OPN и α-SMA постепенно, указывая на то, что TGFβ3 индуцировал перекрестное связывание коллагена и фенотипический сдвиг ( P <0,05; Рисунок G-I).

A. Инвертированный оптический микроскоп был использован для визуализации прилипания роста человеческих CF к стенке и рассеяния большинства клеток.В отличие от клеток миокарда, МВ не были сгруппированы и не имели спонтанной пульсации. Клетки были идентифицированы с помощью иммунофлуоресценции, и результаты показали, что более 90% клеток с положительной экспрессией DDX2 и FSP-1 культивировались. Влияние TGFβ3 на миграцию клеток, пролиферацию и синтез коллагена: B, анализ CCK-8 применяли для оценки эффектов различных концентраций и времени инкубации rTGFβ3 на пролиферацию в CF человека. C. Анализ МТТ применяли для оценки эффектов различных концентраций и времени инкубации rTGFβ3 на цитотоксичность при CF человека.D, E, анализы Transwell применялись для оценки эффектов различных концентраций rTGFβ3 на миграцию в CF человека. * P <0,05 по сравнению с группой 0 нг / мл rTGFβ3. F, G: Вестерн-блоттинг и полуколичественный анализ экспрессии коллагена I, коллагена III, LOX и OPN в CF человека, обработанных rTGFβ3. Результаты показаны с использованием GAPDH в качестве эндогенного контроля. Данные представлены как среднее значение ± стандартная ошибка среднего. * P <0,05 по сравнению с группой 0 нг / мл rTGFβ3; ** P <0.01 по сравнению с группой 0 нг / мл rTGFβ3; *** P <0,005 по сравнению с группой 0 нг / мл rTGFβ3; H, I, вестерн-блоттинг, иммунофлуоресценция и полуколичественный анализ α-SMA и виментина. Результаты показаны с использованием GAPDH в качестве эндогенного контроля. Данные представлены как среднее значение ± стандартная ошибка среднего. ** P <0,01 по сравнению с группой 0 нг / мл rTGFβ3

3.3. Регулирование гена TGFβ3 с помощью siRNA / pEX4 изменяет экспрессию TGFβ3 в человеческих CF

Для оценки функциональной роли TGFβ3 при инфаркте миокарда TGFβ3 подавлялся с помощью si-TGFβ3 (siRNA-TGFβ3-гомо-1423) и сверхэкспрессировался с помощью pEX4 трансфекция CF человека, эффективность которой была продемонстрирована с помощью ОТ-КПЦР и Вестерн-блоттинга.Результаты показали, что экспрессия TGFβ3 была успешно подавлена ​​в группе si-TGFβ3 и сверхэкспрессирована в группе pEX4-TGFβ3 по сравнению с таковой в контрольной группе ( P <0,05, рисунок A-D).

A, B. Эффективность трансфекции миРНК TGFβ3 была подтверждена с помощью RT-qPCR, Вестерн-блоттинга и полуколичественного анализа. Результаты показаны с использованием GAPDH в качестве эндогенного контроля. Данные представлены как среднее значение ± стандартная ошибка среднего. ** P <0,01 по сравнению с группой si-TGFβ3-NC; *** P <0.005 по сравнению с группой si-TGFβ3-NC; C, D. Эффективность трансфекции плазмиды TGFβ3 подтверждена с помощью RT-qPCR, Вестерн-блоттинга и полуколичественного анализа. Результаты показаны с использованием GAPDH в качестве эндогенного контроля. Данные представлены как среднее значение ± стандартная ошибка среднего. ** P <0,01 по сравнению с группой pEX4-TGFβ3-NC; *** P <0,005 по сравнению с группой pEX4-TGFβ3-NC; E, анализ CCK-8 применяли для оценки эндогенно экспрессируемого TGFβ3 на пролиферацию CF человека. *** P <0.005 по сравнению с группой si-TGFβ3-NC; # P <0,05 по сравнению с группой pEX4-TGFβ3-NC. F, анализ МТТ применяли для оценки эндогенно экспрессируемого TGFβ3 на цитотоксичность CF человека. ** P <0,01 по сравнению с группой si-TGFβ3-NC; # P <0,05 по сравнению с группой pEX4-TGFβ3-NC. G, H, анализ Transwell применяли для оценки эндогенно экспрессируемого TGFβ3 при миграции CF человека. ** P <0,01 по сравнению с группой si-TGFβ3-NC; ## P <0.01 по сравнению с группой pEX4-TGFβ3-NC; I, J, Вестерн-блоттинг экспрессии коллагена I и III, LOX и OPN в CF человека с эндогенным TGFβ3. Результаты показаны с использованием GAPDH в качестве эндогенного контроля. Данные представлены как среднее значение ± стандартная ошибка среднего. * P <0,05 по сравнению с группой si-TGFβ3-NC; ** P <0,01 по сравнению с группой si-TGFβ3-NC; # P <0,05 по сравнению с группой pEX4-TGFβ3-NC. ## P <0,01 по сравнению с группой pEX4-TGFβ3-NC. K, L, вестерн-блоттинг, иммунофлуоресценция и полуколичественный анализ α-SMA и виментина.Результаты показаны с использованием GAPDH в качестве эндогенного контроля. Данные представлены как среднее значение ± стандартная ошибка среднего. ** P <0,01 по сравнению с группой si-TGFβ3-NC; # P <0,05 по сравнению с группой pEX4-TGFβ3-NC

3.4. Эндогенный TGFβ3 ослаблял скорость пролиферации и миграции, сдвиг фенотипа и экспрессию коллагена, а также способствовал экспрессии LOX и OPN

Мы тестировали эффекты опосредованного нокдауна TGFβ3 siRNA и опосредованной TGFβ3 pEX4 сверхэкспрессии на пролиферацию, миграцию, синтез коллагена и сшивание.Было обнаружено, что пролиферация и миграция CF человека усиливаются через 24 часа, а синтез коллагена усиливается через 48 часов после трансфекции si-TGFβ3, в то время как пролиферация и миграция CF человека ослабляются через 24 часа, а синтез коллагена ослабляется через 48 часов после трансфекции. трансфекция TGFβ3 pEX4-TGFβ3 ( P <0,05; Рисунок E, G-I). МТТ-анализ проводили для выявления цитотоксичности rTGFβ3, и значительного цитотоксического эффекта не наблюдалось (фигура F). Эти данные предполагают потенциальную защитную роль TGFβ3 в подавлении фиброза миокарда.Кроме того, экспрессия LOX, OPN и α-SMA усиливалась TGFβ3 через pEX4-TGFβ3 и подавлялась через siRNA-TGFβ3 через 48 часов после соответствующих трансфекций ( P <0,05; Рисунок F, J-L), что подтвердили ключевую роль TGFβ3 в ремоделировании миокарда.

3.5. TGFβ3 ингибирует синтез коллагена и регулирует фосфорилирование передачи сигналов TGFβ / smad при индуцированном Ang II фиброзе миокарда

Ang II способствует апоптозу, гипертрофии, пролиферации CF и синтезу и секреции ECM путем связывания с рецептором ангиотензина (ATR), что в конечном итоге приводит к ремоделирование.18, 19 анализы CCK-8 и MTT показали, что оптимальная концентрация и время стимуляции Ang II составляли 100 нмоль / л и 24 часа ( P <0,05; Рисунок A, B). Анализ вестерн-блоттинга показал, что экспрессия коллагенов была значительно выше в группе, получавшей Ang II, чем в группе 0 нмоль / л ( P <0,05; Рисунок C). Таким образом, мы обрабатывали CF человека средой, индуцированной Ang II (100 нмоль / л), в течение 24 часов, чтобы определить взаимосвязь между фиброзом миокарда и TGFβ3.Анализ вестерн-блоттинга показал, что экспрессия TGFβ3 была значительно выше в группе, получавшей Ang II, чем в группе 0 нмоль / л ( P <0,05; Рисунок C, D). Эти результаты показали, что стимулирование ИМ может повышать экспрессию TGFβ3, что может коррелировать с фиброзом после ИМ ( P <0,05; Рисунок D). Чтобы изучить роль TGFβ3 (10 нг / мл, 24 часа) в синтезе коллагена, перекрестном связывании и механизме передачи сигнала TGFβ3 в CF, мы проанализировали экспрессию коллагена, LOX, OPN и относительные уровни молекул TGFβ / smad и их фосфорилирование в CF человека.Анализ вестерн-блоттинга, в котором антитела разводили до 1: 1000, показал, что экспрессия коллагена, smad2, smad3 и smad4 и уровни фосфорилирования smad2, smad3 были ниже в группах rTGFβ3 и Ang II + rTGFβ3, чем в контрольной группе и группах Ang II. Кроме того, уровни экспрессии smad7 и фосфорилирования smad7 были заметно выше в группах rTGFβ3 и Ang II + rTGFβ3, чем в контрольной группе и группах Ang II ( P <0,05; Рисунок E, G, H). Вестерн-блоттинг показал, что уровни экспрессии LOX и OPN были выше в группах rTGFβ3 и в группах Ang II + rTGFβ3, чем в контроле и в группах Ang II ( P <0.05; Рисунок F). Важно отметить, что без сайта мотива фосфорилирования серина в своей структуре smad4 не может быть фосфорилирован, 21 поэтому фосфорилированный smad4 не оценивался.

Анализы

A, B, CCK-8 и MTT применяли для оценки пролиферации Ang II-индуцированных CF человека. Данные представлены как среднее значение ± стандартная ошибка среднего. C, Вестерн-блоттинг и полуколичественный анализ экспрессии коллагена Ⅰ и Ⅲ в Ang Ⅱ-обусловленных CF человека. Результаты показаны с использованием GAPDH в качестве эндогенного контроля. Данные представлены как среднее значение ± стандартная ошибка среднего.* P <0,05 по сравнению с группой 0 нмоль / л; ** P <0,01 по сравнению с группой 0 нмоль / л; *** P <0,005 по сравнению с группой 0 нмоль / л; D, Вестерн-блоттинг и полуколичественный анализ, показывающий уровни экспрессии TGFβ3 в CF человека при различных концентрациях Ang II. Результаты показаны с использованием GAPDH в качестве эндогенного контроля. Данные представлены как среднее значение ± стандартная ошибка среднего. * P <0,05 по сравнению с группой 0 нмоль / л; ** P <0,01 по сравнению с группой 0 нмоль / л.E, F, вестерн-блоттинг и полуколичественный анализ экспрессии коллагена Ⅰ, коллагена, LOX и OPN при обработке Ang (100 нмоль / л) и TGFβ3 (10 нг / мл) в течение 24 часов в CF человека. Результаты показаны с использованием GAPDH в качестве эндогенного контроля. Данные представлены как среднее значение ± стандартная ошибка среднего. * P <0,05 по сравнению с контрольной группой; ** P <0,01 по сравнению с контрольной группой; *** P <0,005 по сравнению с контрольной группой; # P <0,05 по сравнению с группой Ang Ⅱ; ### P <0.005 по сравнению с группой Ang Ⅱ; G, H, эффект p; Обработка 24-ч-Ang Ⅱ (100 нмоль / л) -TGFβ3 (10 нг / мл) сигнального пути TGFβ / smad и относительной экспрессии белка. Вестерн-блоттинг и полуколичественный анализ экспрессии t-smad2, t-smad3, smad4, t-smad7, p-smad2, p-smad3 и p-smad7 в CF человека с использованием GAPDH и общего smad в качестве эндогенного контроля. Данные представлены как среднее значение ± SEM. * P <0,05 по сравнению с контрольной группой; ** P <0,01 по сравнению с контрольной группой; *** P <0.005 по сравнению с контрольной группой; # P <0,05 по сравнению с группой Ang Ⅱ; ## P <0,01 по сравнению с группой Ang; ### P <0,005 по сравнению с группой Ang Ⅱ

3,6. TGFβ3 стимулировал экспрессию smad7

. Для анализа эффектов TGFβ3 на уровни экспрессии и фосфорилирования smad7 человеческие CF предварительно обрабатывали различными концентрациями TGFβ3 в течение 24 часов. Результаты показали, что по сравнению с контрольной группой TGFβ3 значительно увеличивал экспрессию smad7 и p-smad7 ( P <0.05; Рисунок А). Вестерн-блоттинг показал, что уровни экспрессии и фосфорилирования smad7 были ослаблены в группах si-TGFβ3, тогда как уровни экспрессии smad7 и p-smad7 увеличились через 48 часов после трансфекции pEX4-TGFβ3 ( P <0,05; Рисунок B) . Эти результаты подтвердили ключевую роль smad7 в эффекте TGFβ3 против фиброза миокарда.

A, Вестерн-блоттинг и полуколичественный анализ экспрессии smad7 и p-smad7 в CF человека, обработанных различными концентрациями rTGFβ3.GAPDH и общий smad использовали в качестве эндогенного контроля. Данные представлены как среднее значение ± стандартная ошибка среднего. ** P <0,01 по сравнению с группой 0 нг / мл rTGFβ3; * P <0,005 по сравнению с группой 0 нг / мл rTGFβ3; B, Вестерн-блоттинг и полуколичественный анализ экспрессии smad7 и p-smad7 в CF человека, обработанных эндогенным TGFβ3. GAPDH и общий smad использовали в качестве эндогенного контроля. Данные представлены как среднее значение ± стандартная ошибка среднего. * P <0,05 по сравнению с группой si-TGFβ3-NC; ** P <0.051 по сравнению с группой si-TGFβ3-NC; ## P <0,01 по сравнению с группой pEX4-TGFβ3-NC; ### P <0,005 по сравнению с группой pEX4-TGFβ3-NC; C. Эффективность трансфекции siRNA smad7 была подтверждена с помощью RT-qPCR. Результаты показаны с использованием GAPDH в качестве эндогенного контроля. *** P <0,005 по сравнению с группой si ‐ smad7 ‐ NC; D. Эффективность трансфекции siRNA smad7 подтверждена вестерн-блоттингом и полуколичественным анализом. Результаты показаны с использованием GAPDH в качестве эндогенного контроля.Данные представлены как среднее значение ± стандартная ошибка среднего. *** P <0,005 по сравнению с группой si ‐ smad7 ‐ NC; E, F, анализ Transwell и анализ количества клеток использовались для обработки 24-ч-Ang Ⅱ (100 нмоль / л) -TGFβ3 (10 нг / мл) и клеток трансфекции 48-ч-si-smad7 для оценки эффекта миграции smad7 на человеческих CF. *** P <0,005 по сравнению с группой Ang Ⅱ; ### P <0,005 по сравнению с группой rTGFβ3; &&& P <0,005 по сравнению с группой Ang Ⅱ + rTGFβ3. G, анализ CCK-8 использовали для обработки 24-часового Ang Ⅱ (100 нмоль / л) -TGFβ3 (10 нг / мл) и клеток трансфекции 48-час-si-smad7 для оценки пролиферационного эффекта smad7 на CF человека. .*** P <0,005 по сравнению с группой Ang Ⅱ; ### P <0,005 по сравнению с группой rTGFβ3; &&& P <0,005 по сравнению с группой Ang Ⅱ + rTGFβ3. Анализ H, MTT использовали для обработки 24-ч-Ang Ⅱ (100 нмоль / л) -TGFβ3 (10 нг / мл) и клеток трансфекции 48-ч-si-smad7 для оценки цитотоксического эффекта smad7 на CF человека. * P <0,05 по сравнению с группой Ang Ⅱ; ### P <0,005 по сравнению с группой rTGFβ3; &&& P <0.005 по сравнению с группой Ang Ⅱ + rTGFβ3

3.7. Молчание гена smad7 с помощью siRNA ингибировало экспрессию smad7 в CF человека.

siRNA Smad7 трансфицировали в CF человека. ОТ-КПЦР и Вестерн-блоттинг были использованы для определения эффективности сайленсинга. Результаты показали, что si ‐ smad7 (si ‐ smad7 ‐ homo ‐ 824) успешно ослабляет экспрессию smad7 ( P <0,05, рисунок C, D).

3.8. Smad7 ингибирует пролиферацию и миграцию CF человека, индуцированную Ang II

Пролиферация и миграция CF человека играют важную роль в фиброзе миокарда.Мы обрабатывали CF человека si-smad7 в течение 24 часов, затем Ang II (100 нмоль / л) и rTGFβ3 (10 нг / мл) в течение 24 часов, чтобы определить взаимосвязь между TGFβ3 и samd7 в период после ИМ. Миграция через лунки, анализы CCK-8 были использованы для оценки эффектов si-smad7 на миграцию и пролиферацию CF человека. Результаты показали, что скорость миграции и пролиферации клеток была значительно выше в группе, получавшей si-smad7-Ang II, группе si-samd7-TGFβ3 и группе si-smad7-Ang II + rTGFβ3, чем в группе, получавшей Ang II. , группа rTGFβ3, группа Ang II + rTGFβ3 соответственно.МТТ-анализ был проведен для выявления цитотоксичности si-smad7, Ang II и rTGFβ3, и значительного цитотоксического эффекта не наблюдалось. Эти результаты подтвердили ключевую роль smad7 в определенном эффекте TGFβ3 против пролиферации и миграции CF человека ( P <0,05, рисунок E-H).

3.9. TGFβ3 влияет на Ang II-индуцированный фиброз миокарда посредством передачи сигналов TGFβ / smad, что может быть связано с регуляцией smad7.

Мы провели вестерн-блоттинг, чтобы изучить роль smad7 в сигнальном пути TGFβ / smad, который, как уже упоминалось, активируется TGFβ3. ранее (рисунки G, H и A, B).Эти данные подтвердили ключевую роль smad7 в защитном эффекте TGFβ3 против фиброза миокарда. Мы обрабатывали CF человека si-smad7 в течение 24 часов, затем Ang II (100 нмоль / л) и rTGFβ3 (10 нг / мл) в течение еще 24 часов, чтобы определить влияние smad7 на индуцированный Ang II синтез коллагена. Когда антитела разводили в соотношении 1: 2000, экспрессия коллагена Ⅰ, коллагена III, smad2, smad3 и smad4 и уровни фосфорилирования smad2 и smad3 были выше в группе, получавшей si-smad7-Ang II, si-smad7 -RTGFβ3 и группа si-smad7-Ang II + rTGFβ3, чем группа, обработанная Ang II, группа rTGFβ3, группа Ang II + rTGFβ3 соответственно ( P <0.05 Рисунок A-C). Эти результаты показали, что TGFβ3 влияет на индуцированный Ang II фиброз миокарда посредством передачи сигналов TGFβ / smad, в которой может участвовать smad7.

A, B, C, вестерн-блоттинг и полуколичественный анализ экспрессии коллагена Ⅰ, коллагена Ⅲ, t-smad2, p-smad2, t-smad3, p-smad3 и smad4 в CF человека, обработанных 24-h-Ang Ⅱ ( Обработка 100 нмоль / л) -TGFβ3 (10 нг / мл) и клетки для трансфекции 48-ч-si-smad7. GAPDH и общий smad использовали в качестве эндогенных контролей. Данные представлены как среднее значение ± стандартная ошибка среднего.* P <0,05 по сравнению с группой Ang Ⅱ; ** P <0,01 по сравнению с группой Ang Ⅱ; *** P <0,005 по сравнению с группой Ang Ⅱ; # P <0,05 по сравнению с группой rTGFβ3; ## P <0,01 по сравнению с группой rTGFβ3; ### P <0,005 по сравнению с группой rTGFβ3; & P <0,05 по сравнению с группой Ang Ⅱ + rTGFβ3; &&& P <0,005 по сравнению с группой Ang Ⅱ + rTGFβ3

4. ОБСУЖДЕНИЕ

После инфаркта миокарда в зоне инфаркта преобладают воспалительные клетки, которые выделяют цитокины, чтобы вызвать миграцию CF в область инфаркта и синтез и секрецию коллагена для замещения некротических клеток. ткань миокарда.22, 23 Исследования показали, что после инфаркта миокарда CF претерпевают фенотипическую трансформацию и приобретают фенотип миофибробластов, которые экспрессируют α-SMA, как для фибробластов, так и для гладкомышечных клеток, чтобы поддерживать функцию поврежденного миокарда.5 Это исследование было сосредоточено на понимании роли TGFβ3 в пост-ИМ. Здесь мы обнаружили, что (а) образцы ИМ человека имели более высокие уровни TGFβ3, чем нормальные образцы; (b) TGFβ3 ингибировал миграцию, пролиферацию CF человека, а определенные концентрации TGFβ3 ослабляли синтез коллагена и связанные с ним экспрессии белков в CF человека; (c) TGFβ3 способствует изменению фенотипа CF человека и перекрестному связыванию коллагена; (d) TGFβ3 влияет на фиброз миокарда посредством передачи сигналов TGFβ / smad, в которой может участвовать smad7.Суперсемейство TGFβ включает в себя TGFβ, активины, ингибины, костные морфогенетические белки (BMP), Nodal, факторы дифференцировки роста (GDF) и антимюллеров гормон (MIS) .7 Хотя роль других членов суперсемейства TGFβ в патологическом фиброзе все еще сохраняется. В ходе исследований подсемейство TGFβ, состоящее из TGFβ1, 2 и 3, давно известно, играет критическую роль в патологическом фиброзе. Большое количество исследований показало, что TGFβ1 и TGFβ2 связаны с патологическим фиброзом.24, 25 В отличие от TGFβ1 или TGFβ2, TGFβ3, по-видимому, является очень многообещающим ингибитором патологического фиброза кожи, слизистой оболочки 26 голосовых складок, 27 роговицы 28 и легких.29 В нашем исследовании относительно более высокие уровни экспрессии TGFβ1, TGFβ2 и TGFβ3 были обнаружены в образцах с инфарктом, чем в контрольных образцах. Мы обнаружили, что более высокая экспрессия TGFβ3 была обнаружена на поздней стадии, чем на ранней. Кроме того, соответствующая литература по экспериментам на животных показала, что пик TGFβ3 был достигнут на 32-й день после MI.11 Аналогичным образом мы обнаружили, что TGFβ3 секретируется постепенно и достигал пика через один месяц после MI. Напротив, экспрессия TGFβ1 и TGFβ2 показала противоположную тенденцию.Исследование рубцевания после ожогов показало, что уровни TGFβ1 значительно увеличились в течение первых 2 недель после травмы, а затем снизились, 30 в то время как при заживлении ран без рубцов наблюдалось стойкое повышение уровня TGFβ3.10 Следовательно, сложные изменения в соотношении изоформ TGFβ будут привести к ремоделированию тканей. Таким образом, понимание TGFβ3 необходимо для определения взаимосвязи между изоформами TGFβ.

CF играют решающую роль в поддержании гомеостаза ВКМ в ответ на патологические стимулы.Было показано, что DDR2,31 FSP-1 32 и обнаруженный нами виментин были предложены в качестве маркеров сердечных фибробластов и фибробластов. Эти клетки выполняют множество функций, включая синтез и отложение ECM, межклеточную коммуникацию и передачу сигналов с миоцитами, другими CF и эндотелиальными клетками. В частности, биологическое поведение CF нарушается во время ремоделирования миокарда. Фиброз в основном характеризуется миграцией и пролиферацией CFs.33, 34 Сообщалось, что TGFβ3 может ослаблять пролиферацию и дифференцировку CFs в коже.36 Кроме того, Саймон Н. и Уоддингтон и др. Представили убедительные доказательства того, что присутствие mutTGFβ3 в области раны значительно снижает количество CF, замедляет миграцию CF и снижает синтез коллагена в области раны.9 В этом исследовании мы обнаружили, что TGFβ3 увеличивал миграцию, пролиферацию и синтез коллагена при 5 нг / мл и ослаблял миграцию, пролиферацию и синтез коллагена при 10 и 50 нг / мл. Сообщалось, что синтез коллагена стимулировался в ответ на TGFβ3 посредством TGFβ1-зависимого и TGFβ1-независимого способов, 37 что указывает на то, что повышение уровней TGFβ1 может быть результатом увеличения уровней TGFβ3.Как мы показали ранее, TGFβ3 постепенно увеличивался со временем инфаркта, когда отношение TGFβ1 к TGFβ3 изменялось, преобладало ингибирование TGFβ3 и все тело испытывало эффект ингибирования.

Сообщалось, что фибробласты исчезают в конце фибропролиферативной фазы при нормальном заживлении ран, 38 что позволяет предположить, что TGFβ3 играет доминирующую роль в фиброзной фазе ремоделирования миокарда. На этой части фазы созревания CFs приобрели способность ремоделировать ECM посредством активированных интегринов и белков рецепторов кадгерина.39 Они продуцируют высокие уровни проколлагеновых фибрилл, сшитых LOX, 40 и LOX активируется OPN.41 В условиях ИМ подмножество активированных сердечных фибробластов приобретает новые фенотипические характеристики, включая экспрессию сократительного белка α -SMA способствует патологическому ремоделированию сердца.5 В этом исследовании мы обнаружили, что экспрессия LOX, OPN и α-SMA постоянно увеличивается с увеличением концентрации TGFβ3, что показало разные результаты для коллагенов.Кроме того, LOX, OPN и α-SMA были усилены pEX4-TGFβ3 и ослаблены si-TGFβ3. Взятые вместе, это указывает на то, что TGFβ3 может способствовать ремоделированию миокарда.

Таким образом, TGFβ3 может опосредовать ослабляющий эффект на пролиферацию CF, продукцию ECM и фиброз миокарда, а также стимулирующий эффект на перекрестное связывание коллагена, что может обеспечить новое понимание и основанную на TGFβ3 терапевтическую стратегию ремоделирования миокарда. Фиброз, основная причина ремоделирования миокарда, коррелирует с отложением избыточных белков ЕСМ, таких как коллагены.Гомеостаз коллагена играет ключевую роль в фиброзе миокарда. Сообщалось, что TGFβ3 играет защитную роль при фиброзе поджелудочной железы42 и фиброзе печени43, ослабляя экспрессию коллагена Ⅰ и. Хорошо известно, что Ang II является мощным и ключевым профибротическим фактором в пролиферации, миграции, синтезе коллагена и перекрестном связывании. 44 Между тем, Ang II, который увеличивается со временем инфаркта 45, значительно способствует экспрессии TGFβ3. Основываясь на этих результатах, мы дополнительно подтвердили, что TGFβ3 постепенно увеличивается со временем инфаркта.Важно отметить, что стимулирование ИМ может повышать экспрессию TGFβ3, что может коррелировать с фиброзом после ИМ. Мы исследовали, регулирует ли TGFβ3 синтез коллагена I, III, LOX и OPN после ИМ. Результаты показали ослабленную экспрессию коллагена I и коллагена III в группах Ang II + rTGFβ3. В то время как повышенная экспрессия LOX и OPN была обнаружена в группах Ang II, группах rTGFβ3 и группах Ang II + rTGFβ3. Таким образом, мы предположили, что TGFβ3 может оказывать защитное действие против индуцированного Ang II фиброза миокарда.

Передача сигналов TGFβ опосредуется в основном парой трансмембранных рецепторов серин-треонинкиназы, называемых TβRI (или активиноподобная киназа-5, ALK5) и TβRII. Рецепторы TGFβ распространяют передачу сигнала TGFβ у людей посредством набора smad, включая smad2, smad3, smad4 и smad7; smad2 и smad3 известны как smad активации, а smad4 известен как обычный smad, который играет важную роль в заболеваниях фиброза, повышая активность промотора, реагирующего на smad3. Лиганды TGFβ объединяют TβRI и TβRII для фосфорилирования smad2 и smad3.После активации рецепторами TGFβ фосфорилированные smad2 и smad3 образуют комплекс с smad4 и перемещаются в ядро, где эти белки действуют как факторы транскрипции по отдельности или в сочетании с другими факторами связывания ДНК, чтобы модулировать экспрессию целевого гена.46 Путь передачи сигналов TGFβ / smad может представлять собой важную регуляторную мишень, контролирующую ремоделирование миокарда. Терапевтические агенты, нацеленные на сигнальный путь TGFβ / smad для уменьшения рубцевания, оказались успешными в доклинических исследованиях.7 Ингибиторы рецептора TGFβ ALK5 снижали активность TGFβ, спасали сердечную дисфункцию и улучшали ремоделирование, которое происходит после инфаркта миокарда.47 В модели фиброза блеомицина и легкого фиброзный процесс ослаблялся у мышей без smad3.48, 49 Мы исследовали ослабленные экспрессии коллагена I, коллагена III, smad2, p-smad2, smad3, p-smad3 и smad4 в группах Ang II + rTGFβ3. Таким образом, было подтверждено, что TGFβ3 может ослаблять синтез коллагенов после MI за счет снижения фосфорилирования сигнального пути TGFβ / smad.

Smad7 известен как ингибирующий smad (I-smad) или защитный smad, который выключает сигнальный путь TGFβ / smad.50 В контексте фиброза печени smad7 отрицательно опосредует индуцированный smad3 фиброгенез51. TGFβ3 может регулировать белки smad7 посредством пути передачи сигналов TGFβ / smad, чтобы минимизировать внешние рубцы 52 и фиброз печени. 53 Наш главный интерес состоял в изучении взаимосвязи между активацией TGFβ3 и smad7 при MI. Наши результаты, которые показали, что миграция и пролиферация CF человека и экспрессия коллагена I, коллагена III, smad2, smad3 и smad4, а также уровни фосфорилирования smad2 и smad3 были выше в группах si-smad7, чем в соответствующих контрольных группах, указали на важную роль smad7 в заживлении сердца после инфаркта миокарда.

Согласно нашим экспериментальным результатам, Ang II-индуцированная пролиферация и миграция клеток были значительно ингибированы после подавления smad7. Итак, мы пришли к выводу, что smad7, который принадлежит к суперсемейству smad, расположенному ниже по ходу пути передачи сигналов митоген-активируемой протеинкиназы, обычно противодействует эффектам Ang II на пролиферацию и миграцию клеток. Более того, эффект, вызываемый подавлением smad7, не отменялся обработкой TGFβ3, что ожидалось, потому что smad7 находится ниже по ходу пути сигнального пути TGFβ3.В конечном итоге мы рассмотрели возможность новых терапевтических подходов, нацеленных на TGFβ3 и smad7, для лечения индуцированного ИМ ремоделирования миокарда.

5. ЗАКЛЮЧЕНИЕ

Наши результаты показали, что TGFβ3 может ослаблять пролиферацию, миграционную способность и синтез коллагена человеческих CF путем модуляции сигнального пути TGFβ / smad, что может быть связано с регуляцией smad7.

КОНФЛИКТ ИНТЕРЕСОВ

Авторы подтверждают отсутствие конфликта интересов.

БЛАГОДАРНОСТИ

Работа поддержана грантами Министерства образования провинции Ляонин (№ L2016005) и Национального фонда естественных наук Китая (№ 81702834). Кэ Сюэ и Цзюнь Чжан провели исследование, проанализировали данные и написали статью. Лэй Сунь, Сяо Ю, Кэ Сюэ и Цзюнь Чжан разработали исследование и написали статью.

Банкноты

Сюэ К., Чжан Дж., Ли С. и др. Роль и механизм трансформации фактора роста бета 3 при фиброзе миокарда, вызванном инфарктом миокарда человека.J Cell Mol Med. 2019; 23: 4229–4243. 10.1111 / jcmm.14313 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

Кэ Сюэ и Цзюнь Чжан внесли равный вклад в эту работу.

ССЫЛКИ

1. Frantz S, Bauersachs J, Ertl G. Постинфарктное ремоделирование: вклад в заживление ран и воспаление. Cardiovasc Res. 2009; 81: 474-481. [Бесплатная статья PMC] [PubMed] [Google Scholar] 2. Гонсалес ‐ Сантамария Дж., Вильяльба М., Буснадьего О. и др. Сшивающие матрикс лизилоксидазы индуцируются в ответ на инфаркт миокарда и способствуют сердечной дисфункции.Cardiovasc Res. 2016; 109: 67-78. [PubMed] [Google Scholar] 3. Сулейман М., Абдулрахман Н., Ялцин Х., Мрайше Ф. Роль CD44, гиалуронана и NHE1 в ремоделировании сердца. Life Sci. 2018; 209: 197-201. [PubMed] [Google Scholar] 4. Юнг М., Ма И, Айер Р.П. и др. IL-10 улучшает ремоделирование сердца после инфаркта миокарда, стимулируя поляризацию макрофагов M2 и активацию фибробластов. Basic Res Cardiol. 2017; 112: 33. [Бесплатная статья PMC] [PubMed] [Google Scholar] 5. Вебер К.Т., Сан Й., Бхаттачарья С.К., Ахокас Р.А., Герлинг И.К.Опосредованные миофибробластами механизмы патологического ремоделирования сердца. Nat Rev Cardiol. 2013; 10: 15‐26. [PubMed] [Google Scholar] 6. ван ден Борн С., Диц Дж., Бланкестейн В. М., Верьанс Дж., Хофстра Л., Нарула Дж. Ремоделирование миокарда после инфаркта: роль миофибробластов. Nat Rev Cardiol. 2010; 7: 30-37. [PubMed] [Google Scholar] 7. Finnson KW, McLean S, Di Guglielmo GM, Philip A. Динамика передачи сигналов трансформирующего фактора роста бета при заживлении ран и рубцевании. Adv Уход за раной. 2013; 2: 195-214.[Бесплатная статья PMC] [PubMed] [Google Scholar] 8. Cox DA. Трансформирующий фактор роста-бета 3. Cell Biol Int. 1995; 19: 357-371. [PubMed] [Google Scholar] 9. Уоддингтон С.Н., Кроссли Р., Шеард В. и др. Доставка гена мутанта TGFbeta3 снижает маркеры образования рубцовой ткани после кожных ран. Mol Ther. 2010; 18: 2104-2111. [Бесплатная статья PMC] [PubMed] [Google Scholar] 10. Фергюсон М.В., О’Кейн С. Исцеление без шрамов: от эмбриональных механизмов до терапевтического вмешательства для взрослых. Philos Trans R Soc Lond B Biol Sci.2004; 359: 839-850. [Бесплатная статья PMC] [PubMed] [Google Scholar] 11. Deten A, Hölzl A, Leicht M, Barth W, Zimmer H ‐ G. Изменения внеклеточного матрикса и изоформ трансформирующего фактора роста бета после перевязки коронарной артерии у крыс. J Mol Cell Cardiol. 2001; 33: 1191-1207. [PubMed] [Google Scholar] 12. Mehta PK, Griendling KK. Передача сигналов клеток ангиотензина II: физиологические и патологические эффекты в сердечно-сосудистой системе. Am J Physiol Cell Physiol. 2007; 292: C82-97. [PubMed] [Google Scholar] 13.Zhang Z-Z, Wang W, Jin H-Y и др. Апелин является негативным регулятором опосредованного ангиотензином II неблагоприятного ремоделирования и дисфункции миокарда. Гипертония. 2017; 70: 1165-1175. [PubMed] [Google Scholar] 14. Грин Д.Э., Мерфи Т.К., Канг Би-Й и др. Ингибитор Nox4 GKT137831 ослабляет индуцированную гипоксией пролиферацию легочных сосудистых клеток. Am J Respir Cell Mol Biol. 2012; 47: 718-726. [Бесплатная статья PMC] [PubMed] [Google Scholar] 15. Виллапол С., Яшемский А.К., Логан Т.Т. и др. Кандесартан, блокатор AT (1) -рецепторов ангиотензина II и агонист PPAR-гамма, уменьшает объем поражения и улучшает двигательную функцию и функцию памяти после черепно-мозговой травмы у мышей.Нейропсихофармакология. 2012; 37: 2817-2829. [Бесплатная статья PMC] [PubMed] [Google Scholar] 16. Шмирер Б., Хилл С.С. Передача сигнала TGFbeta-SMAD: молекулярная специфичность и функциональная гибкость. Nat Rev Mol Cell Biol. 2007; 8: 970-982. [PubMed] [Google Scholar] 17. Кумар В., Абул К., Основная патология Джона С. Роббинса, 10-е изд. Филадельфия, Пенсильвания: Эльзевьер; 2018. [Google Scholar] 18. Вильярреал Ф.Дж., Ким Н.Н., Унгаб Г.Д., Принц МП, Диллманн WH. Идентификация функциональных рецепторов ангиотензина II на сердечных фибробластах крыс.Тираж. 1993; 88: 2849-2861. [PubMed] [Google Scholar] 19. Ким С., Ивао Х. Молекулярные и клеточные механизмы опосредованных ангиотензином II сердечно-сосудистых и почечных заболеваний. Pharmacol Rev.2000; 52: 11-34. [PubMed] [Google Scholar] 20. Ма Т, Кам К, Ян Б.П., Лам Й-Й. Блокада ренин-ангиотензин-альдостероновой системы при сердечно-сосудистых заболеваниях: текущее состояние. Br J Pharmacol. 2010; 160: 1273-1292. [Бесплатная статья PMC] [PubMed] [Google Scholar] 21. Хендерсон К.Д., Эндрю DJ. Идентификация нового SMAD дрозофилы на Х-хромосоме.Biochem Biophys Res Comm. 1998; 252: 195-201. [PubMed] [Google Scholar] 23. Браун Р.Д., Амблер С.К., Митчелл М.Д., Лонг CS. Сердечный фибробласт: терапевтическая мишень при ремоделировании и недостаточности миокарда. Annu Rev Pharmacol Toxicol. 2005; 45: 657-687. [PubMed] [Google Scholar] 24. March JT, Golshirazi G, Cernisova V, et al. Нацеливание передачи сигналов TGFbeta на устранение фиброза с использованием антисмысловых олигонуклеотидов. Биомедицины. 2018; 6: 74. [Бесплатная статья PMC] [PubMed] [Google Scholar] 25. Элдред Дж. А., Ходжкинсон Л. М., Дауэс Л. Дж. И др.Активность MMP2 является критической для индуцированного TGFbeta2 сокращения матрикса — последствий для фиброза. Инвестируйте Ophthalmol Vis Sci. 2012; 53: 4085-4098. [PubMed] [Google Scholar] 26. Окклстон Н.Л., Лаверти Х.Г., О’Кейн С. и др. Профилактика и уменьшение рубцов на коже с помощью трансформирующего фактора роста бета 3 (TGF beta 3): от лабораторных открытий до клинических фармацевтических препаратов. J Biomat Sci-Polym E. 2008; 19: 1047-1063. [PubMed] [Google Scholar] 27. Чанг З., Кисимото Ю., Хасан А. и др. TGF-beta 3 модулирует воспалительную среду и уменьшает образование рубцов после повреждения слизистой оболочки голосовых складок у крыс.Dis Model Mech. 2014; 7: 83-91. [Бесплатная статья PMC] [PubMed] [Google Scholar] 28. Sriram S, Tran JA, Guo X и др. Разработка моделей заживления ран для изучения влияния TGFbeta3 на СМА. Exp Eye Res. 2017; 161: 52-60. [Бесплатная статья PMC] [PubMed] [Google Scholar] 29. Спросите К., Бонниауд П., Маасс К. и др. Прогрессирующий фиброз легких опосредуется изоформой 1 TGF-beta, но не TGF-beta3. Int J Biochem Cell Biol. 2008; 40: 484-495. [Бесплатная статья PMC] [PubMed] [Google Scholar] 30. Рорисон П., Томлинсон А., Хассан З., Робертс С.А., Фергюсон М., Шах М.Продольные изменения в плазме Трансформирующий фактор роста бета-1 и послеожоговые рубцы у детей. Бернс. 2010; 36: 89-96. [PubMed] [Google Scholar] 31. Голдсмит Э. К., Хоффман А., Моралес М. О. и др. Организация фибробластов в сердце. Dev Dyn. 2004; 230: 787-794. [PubMed] [Google Scholar] 32. Россини М., Чюнсучон Б., Доннерт Э. и др. Иммунолокализация фактора роста фибробластов-1 (FGF-1), его рецептора (FGFR-1) и фибробласт-специфического белка-1 (FSP-1) при воспалительном заболевании почек. Kidney Int.2005; 68: 2621-2628. [PubMed] [Google Scholar] 33. Ли М., Цю Л., Ху В. и др. Генетически модифицированные костные мезенхимальные стволовые клетки с TGF-beta3 улучшают заживление ран и уменьшают образование рубцовой ткани на модели кролика. Exp Cell Res. 2018; 367: 24-29. [PubMed] [Google Scholar] 34. Станке Т., Ковтарапу Б.С., Стахс О. и др. Подавление пути TGF-бета пирфенидоном снижает отложение внеклеточного матрикса в глазных фибробластах in vitro. PLoS ONE. 2017; 12: e0172592. [Бесплатная статья PMC] [PubMed] [Google Scholar] 35.Fang F, Huang R-L, Zheng Y, Liu M, Huo R. Мезенхимальные стволовые клетки, полученные из костного мозга, подавляют пролиферативный и профибротический фенотип гипертрофических фибробластов рубца и келоидных фибробластов посредством паракринной передачи сигналов. J Dermatol Sci. 2016; 83: 95-105. [PubMed] [Google Scholar] 36. Ву И, Пэн И, Гао Д. и др. Мезенхимальные стволовые клетки подавляют пролиферацию фибробластов и уменьшают фиброз кожи за счет TGF-beta3-зависимой активации. Int J Раны нижних конечностей. 2015; 14: 50-62. [PubMed] [Google Scholar] 37.Мурата Х., Чжоу Л., Очоа С. и др. TGF-beta3 стимулирует и регулирует синтез коллагена посредством TGF-beta1-зависимых и независимых механизмов. J Invest Dermatol. 1997; 108: 258-262. [PubMed] [Google Scholar] 38. Линге С., Ричардсон Дж., Вигор С., Клейтон Э., Хардас Б., Рольф К.Дж. Гипертрофические рубцовые клетки неспособны подвергнуться апоптозу, специфичному для сократительного коллагена — роли тканевой трансглутаминазы. J Invest Dermatol. 2005; 125: 72-82. [PubMed] [Google Scholar] 39. Нагараджу С.К., Дрис Э., Попович Н. и др.Глобальная активация фибробластов по всему левому желудочку, но локализованный фиброз после инфаркта миокарда. Научный доклад 2017; 7: 10801. [Бесплатная статья PMC] [PubMed] [Google Scholar] 40. Адам О, Теобальд К., Лавалл Д. и др. Повышенная экспрессия лизилоксидазы и перекрестное связывание коллагена во время фибрилляции предсердий. J Mol Cell Cardiol. 2011; 50: 678-685. [PubMed] [Google Scholar] 41. Лопес Б., Гонсалес А., Линднер Д. и др. Остеопонтин-опосредованный фиброз миокарда при сердечной недостаточности: роль лизилоксидазы? Cardiovasc Res.2013; 99: 111-120. [PubMed] [Google Scholar] 42. Шек Ф.В., Ли К.Ф., Манн Дж. И др. Трансформирующий фактор роста-бета3 (TGF-бета 3) проявляет антифиброзные свойства в звездчатых клетках поджелудочной железы. Кишечник. 2004; 53: A16 ‐ A. [Google Scholar] 43. Чжан И, Лю П, Гао Х и др. rAAV2-TGF-beta (3) снижает синтез и отложение коллагена в печени крыс с экспериментальным фиброзом печени. Dig Dis Sci. 2010; 55: 2821-2830. [PubMed] [Google Scholar] 44. Галан М., Варона С., Гуадалл А. и др. Сверхэкспрессия лизилоксидазы ускоряет ремоделирование сердца и усугубляет гипертрофию, вызванную ангиотензином II.Фасеб Дж. 2017; 31: 3787-3799. [PubMed] [Google Scholar] 45. Sadoshima J-I, Xu Y, Slayter HS, Izumo S. Аутокринное высвобождение ангиотензина II опосредует индуцированную растяжением гипертрофию сердечных миоцитов in vitro. Клетка. 1993; 75: 977-984. [PubMed] [Google Scholar] 47. Тан С.М., Чжан Ю., Коннелли К.А. и др. Направленное ингибирование передачи сигналов киназы 5, подобной рецептору активина, ослабляет сердечную дисфункцию после инфаркта миокарда. Am J Physiol Heart Circ Physiol. 2010; 298: х2415 ‐ х2425. [PubMed] [Google Scholar] 48.Эшкрофт Г.С., Ян Х, Глик А.Б. и др. У мышей, лишенных Smad3, наблюдается ускоренное заживление ран и нарушенная местная воспалительная реакция. Nat Cell Biol. 1999; 1: 260-266. [PubMed] [Google Scholar] 49. Чжао Дж., Ши В., Ван Ю.Л. и др. Дефицит Smad3 ослабляет вызванный блеомицином фиброз легких у мышей. Am J Physiol Lung Cell Mol Physiol. 2002; 282: L585 ‐ L593. [PubMed] [Google Scholar] 50. Кавсак П., Расмуссен Р.К., Causing CG и др. Smad7 связывается со Smurf2 с образованием убиквитинлигазы E3, которая нацелена на бета-рецептор TGF для деградации.Mol Cell. 2000; 6: 1365-1375. [PubMed] [Google Scholar] 51. Сюй Ф., Лю Ц., Чжоу Д. и др. Путь TGF ‐ beta / SMAD и его регуляция при фиброзе печени. J Histochem Cytochem. 2016; 64: 157-167. [Бесплатная статья PMC] [PubMed] [Google Scholar] 52. Jiang K, Chun G, Wang Z и др. Влияние трансформирующего фактора роста-бета3 на экспрессию Smad3 и Smad7 в теноцитах. Мол Мед Реп. 2016; 13: 3567-3573. [PubMed] [Google Scholar] 53. Дэн Л., Хуан Л., Го Кью и др. CREB1 и Smad3 опосредуют индуцированную TGF-beta 3 экспрессию Smad7 в звездчатых клетках печени крыс.Мол Мед Реп.2017; 16: 8455-8462. [PubMed] [Google Scholar]

Руководство по созданию системы Rogue Trader Star

Выписка

Подробное руководство по созданию звездной системы и планет ed s u Y s! быть AN me n M a Ca ith fi G w iSc Неофициальное приложение для Dark Heresy, Rogue Trader и Deathwatch Rogue Trader, Dark Heresy и Deathwatch, авторское право Fantasy Flight Games Warhammer 40k, авторское право Games Workshop Imperium, классы планет, информация, взятая полностью или частично без разрешения от Rouge Trader, Dark Heresy и Lexicanum Images, является оригинальной работой автора или взята из общедоступных источников онлайн Эта работа создана фанатами и не нарушает авторских прав.Право на оригинальную работу принадлежит автору 2010 г. Предисловие Итак, что это тогда? Хотя инструкции по заполнению пустоты, приведенные в «Наборе игрового мастера для вольного торговца», могут быть полезны для создания быстрых звездных систем, иногда мастеру игры требуется более подробное или полное описание. Вот где это входит. Перед вами гораздо более подробный генератор звездной системы. Может быть, слишком подробно. Многие вещи все еще рассматриваются с некоторой степенью необходимой абстракции, но в таблицах и описаниях, многие из которых являются необязательными, гейм-мастера должны найти массу информации для разработки столь подробной звездной системы или планеты, которую они могут пожелать, а также идеи для использования. информация в игре.Эта работа разделена на три части: 1. Создание звездной системы: позволяет мастеру игры разработать довольно полную звездную систему с широким диапазоном условий и переменных. Позволяет создавать одиночные или множественные звездные системы. Подробное создание планет: позволяет создавать подробные планеты с указанием размера, типов атмосферы, криосферы и влажности, среди прочего. Приведены описания типов мира. 2. Все представлено в довольно простом в использовании формате шагов и таблиц.Бери и пользуйся тем, что хочешь. Величайший инструмент мастера игры — это воображение. Надеюсь, это вдохновит вас. Содержание: Содержание раздела Поколение звездной системы Поколение планет Описание планет Империум Мировая классификация Индекс классификации планет Лист данных звездной системы Страница 4 12 17 19 22 25 27 Полезные иллюстрации или диаграммы Спектральные классы и классы яркости Сравнение размеров звезд I Сравнение размеров звезд I Стр. 4 8 11 Будущие дополнения могут включать правила и факты для более подробной информации. экзотические звезды, такие как пульсары, некоторые готовые звездные системы и, возможно, некоторые идеи для создания экзотической ксеножизни.Будущие работы будут загружены как отдельные приложения к этой работе. 3 I. Генерация звездной системы Характеристики звезд, которые нам нужно будет определить. У звезды пять основных характеристик, но здесь нас интересуют только две: (1) спектр или цвет и (2) размер. Цвет зависит от температуры поверхности, а яркость зависит от температуры и размера поверхности. Масса влияет на скорость, с которой звезда данного размера производит энергию, и тем самым влияет на температуру поверхности. Чтобы упростить понимание этих взаимосвязей, астрономы разработали график, называемый диаграммой Герцшпрунга-Рассела (H-R), чтобы помочь астрономам понять и описать жизненные циклы звезд.Классы светимости В 1930-х годах американские астрономы Уильям У. Морган и Филип К. Кинан изобрели то, что стало известно как система классификации светимости МК для этих групп. Астрономы пересмотрели и расширили эту систему в 1978 году. В системе МК самые большие и яркие классы имеют самые низкие классификационные номера. Классы МК: Ia — яркий сверхгигант; Иб, сверхгигант; II, яркий гигант; III, гигант; IV — субгигант; и V, главная последовательность или карлик. Спектральные классы В системе MK существует восемь спектральных классов, каждый из которых соответствует определенному диапазону температуры поверхности.Эти классы от самых горячих до самых холодных: O, B, A, F, G, K и M. Каждый спектральный класс, в свою очередь, состоит из 10 спектральных типов, которые обозначаются буквой для обозначения спектральный класс и числовой. Самым горячим звездам спектрального класса присваивается цифра 0; самые холодные звезды — цифра 9. Таким образом, полное обозначение МК включает символы класса светимости и спектрального класса. Например, полное обозначение солнца — G2V. Альфа Центавра A также является звездой G2V, а обозначение Ригеля — B8Ia.Спектральный класс звезды. Звезда W О Б А Ж К М Класс светимости звезды. Температура поверхности от 30 000 до 150 000 k 30 000 до 60 000 k от 10 000 до 30 000 k 7500 до 10 000 k от 6000 до 7500 k от 5000 до 6000 k от 3500 до 5000 k 20 фунтов Менее светящиеся сверхгиганты Светящиеся гиганты Гиганты Субгиганты Звезды главной последовательности (карликовые звезды) Субкарлики Белые карлики 60 18 3,2 1,3 1,1 0,8 0,3 II III IV Тип Ia Звезды Описание Очень светящиеся сверхгиганты Спектр Сине-фиолетовый Синий Синий Белый Белый Желтоватый Белый Желтый Оранжевый Красный V VI VII Примечание об орбитальном размещении. Используемое здесь расположение орбит основано на законе Титуса-Боде.До сих пор существуют некоторые разногласия по поводу обоснованности теории. Для игровой механики это очень полезно. 4 Начните с определения информации о звездной системе. Выполните пронумерованные шаги. Запись в журнале регистрации данных Star System 1. 2. 3. 4. 5. Определите тип системы. Определите класс и размер звезды. Определите десятичную классификацию. Если звезда является частью системы с несколькими звездами, определите спектральный класс и размер спутника (ей), используя таблицу 4a. Если звезда одиночная, пропустите часть 4. Определите орбитальные зоны вокруг звезды.Если звезда находится в системе с несколькими звездами, можно обратиться к таблице 5b для определения зон вокруг каждой звезды. На этом этапе определите внутреннюю, биологическую и внешнюю зоны звезды, используя соответствующую таблицу для звездного класса. Определите содержимое каждой доступной орбиты. Определите, есть ли захваченные тела. Определить спутники 6. 7. 8. 9. 1. Определите тип системы d10 1-5 6-10 Результат Отдельный множественный 2. Определите звездный класс и размер 2a. Основная звезда 2d10 2-3 4-7 8-12 13-17 18-20 Класс Результат A F G K M 2d10 2 3-4 5-8 9-18 19-20 Размер Результат II III IV V VI Бросьте за каждую звезду в системе 2b.Компаньон для нескольких систем 2d10 2 3-4 5-8 9-13 14-20 Результат класса AFGKM 2d10 2 3 4-6 7-14 15-18 19-20 Результат размера II III IV 8-11 V 12-16 VI 17 — 20 d * VI V dG 2-4 5-7 2c. Карлик звездного класса 2d10 Тип карлика Красные карлики Белые карлики dA dF 3. Бросок на десятичную классификацию 1d10 Для результата от 0 до 9. Поместите после класса и перед размером. то есть: G3 V, O6 III и т. д. ПРИМЕЧАНИЕ: белые карлики класса d не используют десятичную классификацию. Но красные карлики умеют. 5–9 невозможны для классов K и H размера IV.B, A и F0 до 4 невозможны в размере VI. d * Результат: Прокатитесь по таблице 2c. Использование терминов «множественная звездная система», «двойная», «тройная» и т. Д. Звездная система, состоящая из двух звезд, известна как двойная звезда или двойная звездная система. Примеры бинарных систем — Сириус и Процион. Множественные звездные системы — это системы из более чем двух звезд. Множественные звездные системы называются тройными, тройными или тройными, если они содержат три звезды; четверные или четвертичные, если они содержат четыре звезды; пятиместный с пятью звездами; шестерня с шестью звездами; семерка с семью звездами; и так далее.Большинство известных множественных звездных систем являются тройными системами. В рассеянных звездных скоплениях обычно от 100 до 1000 звезд. 5 4а. Орбита звезды-компаньона для нескольких систем 4b. Орбита дальней звезды-компаньона Бросьте 1d10 x 1000, чтобы определить орбитальное расстояние компаньонов в а.е. Сами далекие звезды-компаньоны могут быть множественными системами. Вернитесь к типу системы, чтобы определить. 1d10 Орбита 1 2 3 4 5 6 7 1 Закрыть * 2 1d10 + 2 1d10 + 4 1d10 + 6 1d10 + 8 1d10 + 10 5а. Определить количество орбит ПРИМЕЧАНИЕ: Любая звездная система с небольшими массивными звездами, такими как белый карлик, в пределах 2au от первичной звезды, будет кандидатом на периодические новые звезды.Более массивная звезда меньшего размера выщелачивает звездный материал из менее плотного компаньона. Когда газ сжимается и нагревается на поверхности меньшей звезды или вблизи нее, происходит ядерный синтез материала, разносящий газовую оболочку в результате сильного взрыва новой звезды. В такой системе планеты с близкой орбитой и, возможно, даже внешние планеты могут быть лишены своей атмосферы. Жизнь в том виде, в каком мы ее знаем, на поверхности таких миров будет невозможна. Очень близкие звезды могут физически соприкасаться, что делает изображение очень интересным.Бросок 1d10 Модификаторы Размер Ia, Ib II III Класс M K -6-3 +9 +8 +6 8-10 Прокатка 4б. 5б. Доступные орбиты в системах с несколькими звездами (необязательно) B на орбите между B и A 1 2 3 4 5 6 7 0 0-1 0-1 0-2 0-2 0-3 Beyond B 2+ 3+ 4+ 5+ 6+ 7+ 8+ B Сам по себе 0 0 -1 0-1 0-2 0-2 0-3 0-4 B на орбите между B и A за пределами B 8 9 10 11 12 13 +1 0-3 0-4 0-5 0-6 0-7 0 -8 +1 9+ 10+ 11+ 13+ 14+ 15+ +1 B Сам 0-5 0-6 0-7 0-8 0-4 0-5 +1 6. Карты звездных орбитальных зон. Используйте эти таблицы, чтобы определить внутреннюю, внешнюю и жилую зоны вокруг звезды.Звезды перечислены в порядке их размера. Затем перейдите к шагу 7, Определение орбитального содержимого. Размер звезды d Красный карлик Орбита вокруг звезды Звезда 0 1 2 3 4 5 Примечание: Орбита 0 находится на 0,2 а от звезды. Помните, что белые карлики являются результатом умирающей звезды, поэтому многие внутренние орбиты, 0 4, могут быть пустыми, давным-давно испарившись. Вместо этого в этих зонах могут населять недавно захваченные миры-изгоями или миры, недавно сформированные из обломков старых. Орбита находится во внешней атмосфере звезды. Слишком высокая температура, планета испарится.Внутренняя зона Жилая биозона dK0 dK5 dM0 dM5 Размер звезды d Белый карлик Внешняя зона Звезда dA dF dG 0 Орбита вокруг звезды 1 2 3 4 5 6 Размер звезды Ia Яркие сверхгиганты Обращаются вокруг звезды Звезда W0 W5 O0 O5 B0 B5 A0 A5 F0 F5 G0 G5 K0 K5 M0 M5 M9 1 2 3 4 5 6 7 8 9 10 11 12 13 Размер звезды IB Сверхгиганты вращаются вокруг звезды Звезда W0 W5 O0 O5 B0 B5 A0 A5 F0 F5 G0 G5 K0 K5 M0 M5 R0 R5 NO 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Размер звезды II Яркие гиганты вращаются вокруг звезды Звезда B0 B5 A0 A5 F0 F5 G0 G5 K0 K5 M0 M5 R0 R5 1 2 3 4 5 6 7 8 9 10 11 12 13 Звезда размера III Гиганты вращаются вокруг звезды Звезда B0 B5 A0 A5 F0 F5 G0 G5 K0 K5 M0 M5 R0 R5 1 2 3 4 5 6 7 8 9 10 11 12 13 7 Размер звезды IV Субгиганты вращаются вокруг звезды Звезда B0 B5 A0 A5 F0 F5 G0 G5 K0 Карлик размера VI Орбита вокруг звезды Звезда F5 G0 G5 K0 K5 M0 M5 0 1 2 3 4 5 1 2 3 4 5 6 7 8 9 10 11 12 13 Размер звезды V Основная последовательность Орбита вокруг звезды Звезда O0 O5 B0 B5 A0 A5 F0 F5 G0 G5 K0 K5 M0 M5 M9 1 2 3 4 5 6 7 8 9 10 11 12 13 Примечание о биозонах.Биозона — это область вокруг звезды, где может быть жидкая вода, и, следовательно, жизнь, как мы знаем, возможна. Возможны другие комбинации; то есть миры Iceball с огромными жидкими океанами под поверхностью. Миры, в которых лед нагревается от ядра или приливных напряжений, или миры, вращающиеся вокруг сверхмассивных газовых гигантов, или коричневые карлики, которые сами по себе излучают достаточно тепла, чтобы компенсировать скудное количество тепла от родительской звезды. С другой стороны, жизнь, какой мы ее еще не знаем, может процветать во внутренних и внешних зонах.Вселенная ограничена только вашим воображением! Ригель B8 Ia Альдебаран K5 III Солнце G2 V Канопус F0 II Кастор A A1 V Ахернар B3 V Сравнение звездных размеров. Я. 8 7. Определение орбитального содержания. Используйте эти таблицы для определения внутренней, внешней и обитаемой зоны вокруг звезды. Бросок на каждую орбиту Перейти к следующему шагу. Внутренняя системная зона d100 01-10 11-21 22-40 40-60 61-65 66- 71 72 73 74-87 88 89 90-100 Описание планеты Пустая орбита Пояс астероидов Мезопланета Малая земная Геоактивная сверхземная Малый газовый гигант Газовый гигант Восстановительный газ Сверхгигант Газ Ультрагигант / Коричневый карлик Ультра Враждебный Жилая зона d100 01-10 11-21 22-30 31-40 41-45 46-48 49-56 57 58 59-64 65-70 71-81 72-77 Описание Пустая орбита Пояс астероидов Мезопланета Малая земная Геоактивная суперземная Пустыня Газовый сверхгигант Газовый гигант Маргинальный Маргинальный Земной Сокращение Океанический ледяной газ Ультрагигантский газ Ультрагигант / Коричневый карлик Ультра враждебный Внешняя системная зона d100 01-10 11-21 22 23 24 25-29 30-40 51-71 72-82 83-88 89-94 95-100 Описание Пустая орбита Пояс астероидов Мезопланета Маленькая Земная Геоактивная Сверхземная Газовая сверхгигант Газовый гигант Газовый Ультрагигант Газ Ультрагигант / Коричневый карлик Ледяной мир Грязный снежок 7а.Определить первичный астероид Примечание: Мировые классы Протопланета и Экзотика не должны определяться случайным образом. Протопланетные миры обычно, но не исключительно, находятся в молодых звездных системах с другими протопланетными мирами. Экзотический класс должен быть редкостью. Эти миры и их особенности должны быть назначены Мастером игры, а не оставлены на волю случая. 78 — 83 84 — 89 90 91 92 — 100 Композиция 1d10-2-4 5-7 8-9 ( По желанию ) Состав класса aM aS aC Никель-железо. Возможно, другие тяжелые металлы. Камень и горная порода. Углерод, гидратированные материалы, углеводороды.Водяной лед, замороженный метан, другие замороженные газы или жидкости. Это тела, из которых состоят кометы. 10+ Модификаторы: aI Внутренняя система -2 Биозона -2 Внешняя система +3 9 8. Определите, есть ли какие-либо захваченные планеты в системе (все шаги необязательны). Используйте эту таблицу для определения количества захваченных планет в звездной системе, если есть какие-либо примечания к листу данных звездной системы 8a. Захваченные или красные планеты Количество захваченных планет равно: 1d10 -6 8b. (Необязательно) Создание неправильных орбит. Отметьте орбитальное положение планеты, астероида или кометы, как в шаге 8b.Бросьте еще раз, чтобы получить другое Орбитальное Размещение, как в 8b, на этот раз без модификатора -2, в результате чего у вас останется 2 числа; например 3.6, 10.5. Меньшее число соответствует наибольшему приближению к звезде, большее — наибольшему удалению. Промежуточные орбиты пересекает эта планета. 8b. Размещение захваченных планет Определите расположение каждой на орбите с помощью броска 1d10 +2. Затем сделайте бросок на десятичную дробь, чтобы создать орбитальную позицию, например, 5.8. Определите тип планеты, как и раньше. 8c. Захваченные или нерегулярные / красные астероиды катятся точно так же, как и для захваченной планеты.9. Определите спутники для каждого мира. Используйте эти таблицы, чтобы определить количество спутников в мире. Примечание к таблице данных звездной системы и / или таблице данных планеты Таблица спутников и колец Классы планет Тип Луны Классы Классы Классы Классы Земной, Мезопланета Sm. Газовый гигант Газовый сверхгигант все См. Земной газовый гигант Газовый ультрагигант 1d10 — 9 1d10 — 5 1d10 — 2 Основная информация Типичный размер (1000 км) Минорная кольцевая система Большая кольцевая система Тонкие кольца, состоящие из от микроскопического до пыли, камня или внешней пыли до кристаллов льда, кристаллов льда.Толстые кольца, состоящие из от микроскопических до пыли, камня или внешней системы от кристаллов льда до тем, льда. валуны. Маленькие миры класса B не более чем астероиды, захваченные гравитацией планеты. Во внешней системе это могут быть кусочки льда. Маленький каменистый мир класса B или во внешней системе, ледяные миры класса U или W, без атмосферы. Скалистый класс B или во внешней системе, ледяные миры класса U или W, без атмосферы. Как и выше, возможен разреженный бросок атмосферы, как если бы планета игнорировала броски для суперземного или любого газового гиганта. — — 1d10 — 8 1d10 -5 Moonlets 1d10 — 7 1d10 — 6 1d10 1d10 +3 1 или меньше Маленькие луны 1d10 — 9 1d10 — 7 1d10 — 1 1d10 +1 2 Средние луны — 1d10 — 9 1d10 -3 1d10 Большие луны — — 1d10 — 6 1d10 -4 3-4 Огромные луны — — 1d10 -8 1d10 — 6 5+ 10 9а.Определите расстояние Луны от родительской планеты (необязательно). Негазовые планеты-гиганты используют диаграмму 1 в таблице 10a. Для Газовых гигантов обратитесь к классу и бросьте 1d10, чтобы определить таблицу. Для кольцевых систем см. Таблицу кольцевых систем. Допускается выход на орбиту нескольких спутников. Они называются коорбитальными. Gliese 229B (коричневый карлик) Sun Wolf 072 (dA) 9а. Расстояние Луны от родительской планеты в радиусах 1d10 Roll Малые газовые гиганты Газовые гиганты Ультрагиганты 1-7 1-6 1-4 8-10 7-9 5-8 10 9-10 Таблица 3 Дальние орбиты Расстояние в радиусах 185 190 195 200 205 210 215 220 230 240 250 260 270 280 290 300 320 340 360 Дальние орбиты Кольцевые системы Расстояние в радиусах 1 2 3 4 5 6 7 8 9 10 11 12 14 16 18 20 25 30 35 Gliese 436 (M2.5 В) V 1057 Cyg (dK0) 1d20 Рулон 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 График 1 График 2 Close Orbits Med. Орбиты Расстояние в радиусе Радиусы 15 16 17 18 19 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 95100105110115120125130135140145150155160165170175180 Сравнение размеров звезд. II. Помните, направьте свое оружие на нечистое. Ищите руководства Божественного Императора Человечества, чтобы достичь своей цели. Призовите машинных духов Системы доставки и Постановления, чтобы они могли пробудить и убить врагов человека.Положи Свою Огневую мощь праведно и в великом количестве. Очисти нечистого огнем и стрелой, мечом и лазом. Закрыть Орбитс Мед. Орбиты 9b. Определение расстояния Луны от родительской планеты в км. Необязательно) Радиус планеты x радиус орбиты = расстояние в км. ПРИМЕЧАНИЕ: Захваченные планеты могут иметь очень неправильные орбиты, возможно, пересекая орбиты других миров и вызывая гравитационный хаос в звездной системе, пока они не перейдут на стабильную орбиту или не столкнутся с другой планетой. 11 II. Поколение планеты Используйте эти таблицы для получения подробной информации о планетах. Выполните пронумерованные шаги.Запись в листе записи планетарных данных 1. 2. 3. 4. 5. Определите размер мира. Определите мировую гравитацию. Определите состав атмосферы. Определите гидросферу, криосферу, вулканизм и активность тектонических плит. Определите процентную долю земельной площади. 6. 7. 8. 9. 10. 11. Определите процент относительной влажности. Определите часы в планетных сутках. Определите средние планетарные температуры. Определите общий климат. Определите минералы, найденные на планете. Определите другие интересные предметы. Определите размер мира, диаметр 1а. Не газовые гиганты Описание Протопланета Мезопланета Размер (x1000 км) 2d10 1d10 — 6 Считайте любой результат меньше 1 как 800 км или 0.8 Считать любой результат больше 9 как 9 Любой результат меньше 8 рассматривать как 8 Любой результат меньше 16 как 16 Примечание 1b. Газовые гиганты Тип Размер (x1000 км) Маленький газовый гигант 7d10 +30 Газовый гигант (1d10 x10) +100 Газовый сверхгигант (1d10 x10) +200 Газовый ультгигант / (1d10 x10) +200 Коричневый карлик Примечание: любой газовый гигант диаметром более 140 км является кандидатом на роль коричневого карлика, если он достаточно плотный, в 13 раз или больше массы Юпитера. 1c. Определите размер мира, экваториальную окружность Маленький земной наземный, весь супер-наземный хтонийский ледяной мир Грязный снежный ком Ультра враждебный 1d10 + 3 1d10 + 5 2d10 + 10 2d20 1d10 1d10 1d10 + 5 Считайте любой результат меньше 4 как 4 Любой результат меньше 4 считайте 4 3.1416 x Диаметр = Окружность 1d. Определите размер мира, площадь поверхности (необязательно) (3,1416 x радиус) x 4 = площадь поверхности в км2. Радиус равен 1/2 диаметра. 2. Определите мировую гравитацию (необязательно). Диаметр / 12 = сила тяжести в стандартных единицах ускорения. Истинная ценность человека измеряется его смертью или смертью его врагов. 12 3. Определите состав атмосферы. В таблице ниже указаны возможные атмосферные газы. Это только вероятные рекомендации, основанные на планетном классе. Не стесняйтесь проявлять творческий подход. Помните, что перечисленные газы являются первичным атмосферным газом.Другие газы будут присутствовать в меньших количествах. 3а. Определение атмосфер для планет, отличных от пригодных для обитания Рассматривайте менее 1 как 1, более 10 как 10 (необязательно) 1d10 1-2 3-4 5 6 7-10 1d10 1-5 6-10 Протопланета Нет Водород Сероводород Двуокись углерода Метан 1d10 Рулон 1 2 3 4-7 8-10 Геоактивный Нет Водород Фтористый водород Сероводород Диоксид серы 1d10 Бросок 1-3 4-5 6-8 9-10 Мезопланета Без водорода Гелий Метан Рулон 1d10 1 2 3-4 5-6 Уменьшение или ультра враждебность Водород Бром Соляная кислота Серная кислота Кислород Фтор Хлор Маргинальный Двуокись углерода Метан 1d10 1-5 6-7 8-10 Хтонский Без водорода гелий Ледяной мир, 1d10 Roll Dirty Snowball 1 2 3 — 10 Нет Водород Метан 7 8 9 — 10 Рулон 1d10 1-5 6 7-9 10 Супер земное Двуокись углерода Сероводород Метан Хлор 1d10 Рулон 1-5 6-7 8-10 Малый наземный Без водорода гелий Модификаторы: воспринимайте менее 1 как 1, более 10 как 10.Размер равен диаметру / 1000 Местоположение Внутренняя система -2 Биозона +1 Внешняя система +2 Размер Меньше 5 -2 Свыше 8 +1 3b. Определение плотности атмосферы (необязательно) Необитаемые миры 1d10 Roll 1 2 3 4-5 6-7 8 9 10 Модификаторы:. Размер соответствует диаметру планеты / 1000 Размер меньше 3 3 4 5 6 7 8 9-8-7-6-5-4-3-2-1 Размер 10 11 12 13 14 15 16 17 0 +1 +2 +2 +3 +3 +4 +5 Размер 18 19 20 21 22 23 24 25 + +5 +5 +6 +6 +7 +7 +8 +8 Плотность Очень тонкий Тонкий Очень тонкий Средний Толстый Плотный Очень плотный Приблизительная стандартная плотность земли 0.00000001 0,000001 .01 .3 1 3 10 90 + Пример Земля Луна Меркурий Марс Mt. Эверест Земля Стандарт, Уровень моря Венера 3c. Определение плотности атмосферы для кислородно-азотных миров Только обитаемые наземные миры 1d10 1-2 3-8 9-10 Плотность Стандарт тонкой земли Толстая Приблизительная стандартная плотность земли .5 1 1.5 Пример Стандарт земли на вершине горы, уровень моря 13 4. Определение гидросферы, криосферы, вулканизма и активности тектонических плит. Считайте результаты выше 100 как 100 и ниже 0 как 0. Миры внутренней системы будут иметь рейтинг Гидросферы и Криосферы 0.Газовые гиганты будут иметь 0 баллов в каждой из этих категорий. Описание Протопланета Гидросфера% Биозона 0 Криосфера% Биозона 0 Криосфера% Внешняя система 0 Примечание Поверхность слишком горячая Вулканизм 100 Активность тектонических плит 100 Геоактивный 1d10 x10 1d10 x10 1d10 x10 Планеты внутренней зоны могут иметь небольшое количество водяного льда в тенях и кратерах. 1d10 +5 x10 1d10 +5 x10 Нет Не выше 90 80 1d10 -2 0 Мезопланета 0 0 1d10 x10 Малые наземные наземные, враждебные наземные, пустынные наземные, ледяные наземные, маргинальные наземные, океанические наземные, райские наземные, редуцирующие наземные, ультра враждебные надземные 0 0 2d20 -2 1d10 x10 1d10 / 2 x10 0 1d10 -1 x10 1d10 +7 x10 1d10 x10 1d10 x 10 нет нет 1d10 -6 x10 1d10 -6 x10 1d10 -6 x10 1d10 -6 x10 1d10 -6 x10 1d10 -6 x10 1d10 -6 x10 1d10 -6 x10 1d10 -6 x10 1d10 +7 x10 1d10 -1 x10 1d10 x10 на на 1d10 -6 x10 1d10 -6 x10 1d10 -6 x10 1d10 -6 x10 1d10 x10 1d10 x10 Не выше Не выше 80.80. Не ниже Не ниже 20 не ниже 20 0 0 na Атмосфера и температура могут быть недопустимыми для океанов или льда. Атмосфера и температура могут быть недопустимыми для океанов или льда. 1d10 -6 x10 1d10 -6 x10 на 1d10 -4 x10 1d10 -6 x10 ? 1d10 x10 ? 1d10 x10 ? 1d10 +5 x10 1d10 -5 x10 1d10 -4 x10 1d10 -5 x10 1d10 -6 x10 Грязный снежок на на 1d10 +3 x10 1d10 -7 x10 1d10 -7 x10 Ледяной мир на на 1d10 +7 x10 Может присутствовать небольшое количество льда и пыли, собранных гравитацией планеты. 1d10 -7 x10 1d10 -8 x10 Хтонский 0 0 0 0 0 Миры, отмеченные синим цветом, способны к жизни, подобной земной, и могут быть обитаемы людьми.14 Объяснение используемых терминов Гидросфера: процент поверхности мира, покрытой водой в виде океанов, озер, болот и т. Д. Чем выше это число, тем влажнее мир. Необязательно, в необитаемых, не содержащих кислород азотных мирах с экзотической атмосферой это будет отражать атмосферную смесь. В этих мирах могут быть моря из воды, жидких углеводородов, жидкой соляной кислоты и т. Д. Криосфера: процент поверхности мира, покрытой льдом. Чем выше это число, тем холоднее в мире.Необязательно, в необитаемых, не содержащих кислород азотных мирах с экзотическими океанами это будет отражать смесь гидросферы. Миры типа «ледяной шар» и «грязный снежный ком» будут полностью покрыты водяным льдом, замороженным углекислым газом, замороженным метаном или смесью этих льдов. В других мирах могут быть ледяные шапки и ледники из других химических соединений, замороженные углеводороды, такие как этан и пропан, и т. Д. В этом и вышеупомянутом случае немного времени на изучение. планеты и луны в нашей солнечной системе и различные химические вещества, особенно те, которые имеются в изобилии в природе, и их точки замерзания и плавления, могут иметь большое значение.Вулканизм: используется как относительный индикатор вулканической активности в мире. Мир с низким коэффициентом вулканизма будет иметь небольшую и нечастую вулканическую активность, в то время как более высокий коэффициент будет указывать на более частые и сильные извержения. Для сравнения: Земля в настоящее время имеет оценку 5, Марс — 2, а Ио — 8. Тектоническая активность: используется в качестве относительного индикатора движения тектонических плит в мире и, следовательно, частоты землетрясений. Молодые миры, как правило, будут иметь высокие отношения тектонической активности и вулканизма, причем эти отношения уменьшаются по мере охлаждения и утолщения коры.Для сравнения: Земля в настоящее время имеет оценку 4, Марс — 1, а Венера — предполагаемый 7. 5. Определите процентную долю площади суши 100 — (гидросфера% + криосфера%) = площадь суши. 9. Определите общий климат. Только пригодные для жизни миры. Учитывайте такие вещи, как количество криосферы, влажность, гидросферу. Это предложения, вы можете проявить творческий подход. Ниже приведены некоторые предложения. Криосфера Гидросфера Влажность Низкая Высокая Низкая Низкая Умеренная + Умеренная Умеренная Умеренная Умеренная Высокая Высокая Низкая Низкая Высокая Умеренная Умеренная Умеренная Умеренная Умеренная Высокая Высокая Возможный Климат Горячая пустыня Холодная Пустыня Тропический Умеренный Теплый Умеренный Холодный Умеренный Арктический Саванна Джунгли Холодные тропические леса 6.Определите процент относительной влажности только для обитаемых миров (H, M, O, P) (1d10 + гидросфера) / 2 x10 = относительная влажность в% 7. Определите часы в планетных сутках 3d10 + (размер спутников / 1000) 8. Определите средние планетарные температуры только для обитаемых миров 100 — (Криосфера x10) = Средняя температура в градусах F. Средняя температура +20 = Средняя высокая температура. Средняя температура -20 = Средняя низкая температура. Низкая Умеренная Низкая Высокая Высокая Низкая Низкая Умеренная 15 10. Необязательно: Определите исследование планетных минералов. Только не газовые гиганты Это количество отражает их общее изобилие в рассматриваемом мире.Бросьте 1d10 для каждого модификатора Консультации. Меньше 0 равняется 0. Больше 9 равняется 9. Запись в листе планетарных данных. Планетарные исследования минералов Минералы Обычные металлы Редкие металлы Промышленные кристаллы Драгоценные камни Радиоактивные вещества Рулон 1d10 +3 1d10 +1 1d10 –2 1d10 1d10 –4 1d10 –4 Модификаторы Ледяной мир -4 Ледяной мир -6, Грязный снежок -4 Ледяной мир -8, Грязный снежок -6 Ледяной мир -5, Грязный снежок -3 Ледяной мир -4, Грязный снежок -2 Ледяной мир -3 Приведенные выше числа, умноженные на 10, представляют собой процентную вероятность обнаружения минералов и металлов на планете.Мир с рейтингом 8 по обычным металлам будет иметь 80% -ную вероятность того, что исследование обнаружит жилу коммерчески ценных металлов. Такая планета могла бы считаться потенциально очень богатым горнодобывающим миром, особенно если бы другие рейтинги также были хорошими. При использовании игроками в случайном опросе рейтинг x10 следует использовать как прямой бросок. При активном поиске, чтобы точно определить вену или источник, рейтинг x10 должен быть добавлен в качестве модификатора к соответствующему используемому навыку. Поля и пояса астероидов также должны иметь эти рейтинги, и в этом случае они применяются ко всему поясу.К счастью, вам не нужно бросать вызов для каждого отдельного астероида, если только вы не хотите иметь один или два астероида для особых случаев. Промышленные минералы — это геологические материалы, которые добыты из-за их коммерческой ценности. Они используются в естественном состоянии или после обогащения в качестве сырья или добавок в широком диапазоне применений. Типичными примерами промышленных горных пород и минералов являются известняк, глины, песок, гравий, диатомит, каолин, бентонит, кремнезем, барит, гипс и тальк. Обычные металлы — это основные металлы, используемые в промышленности и добываемые из-за их промышленной ценности.Примеры: никель, медь, железо, свинец, кобальт и другие. Редкие металлы Самыми известными редкими металлами являются золото и серебро. Хотя оба имеют промышленное применение, они более известны своим использованием в искусстве, ювелирных изделиях и чеканке монет. Другие драгоценные металлы включают металлы платиновой группы рутений, родий, палладий, осмий, иридий и платину. Промышленные кристаллы — это природные или синтетические кристаллы, такие как кремний, оксид алюминия, поликристаллические керамические подложки и другие, которые ценятся за их использование в качестве полупроводников, оптических кристаллов, лазерных кристаллов и многих других целей.Драгоценные камни — это минералы или кристаллы, которые ценятся не за их промышленное использование, а за их красоту или редкость. Примеры: алмаз, рубин, аметист, яшма, обсидиан и другие. Радиоактивные вещества добываются из-за их ценности в промышленности, медицине, в качестве топлива или оружия. По большей части радиоактивны минералы, содержащие калий (K), уран (U) и торий (Th). Другие примеры: осмий, самарий, теллур и ванадий. 16 Планетарные описания Пояс астероидов: эта орбита содержит очень маленькие скалистые или металлические объекты размером меньше мезопланеты.Протопланета: мир, недавно сформированный из пылевого диска вокруг молодых звезд. Очень жаркий мир. Частично до полностью расплавленной поверхности. Такой мир мог существовать в более старой системе, сформированной из обломков более раннего планетарного катаклизма. Геоактивность: Часто молодая планета только выходит из стадии протопланет и довольно активна в геологическом отношении. Интенсивное внутреннее тепло на планете может быть также вызвано высокорадиоактивным ядром или экстремальными приливными силами. Мезопланета: также известна как карликовые планеты. Небольшие скалистые или ледяные тела, такие как Луна, Плутон или Церера.Small Terrestrial: небольшой скалистый мир, возможно, с небольшим металлическим ядром, больше мезопланеты. Может иметь тонкую или разреженную атмосферу. Земной, враждебный: более крупный скалистый мир, часто с металлическим ядром. Непригодны для жизни, какой мы ее знаем, по ряду причин, таких как отсутствие или отравляющая атмосфера, радиация и т. Д. Многие Мертвые миры попадают в эту категорию. Земной, пустынный: мир, способный поддерживать жизнь. Условия везде засушливые. Первичная местность — жаркая или холодная пустыня, хотя условия могут быть лучше ближе к полюсам.Земной, ледяной: мир, способный поддерживать жизнь в ловушке ледникового периода. Условия у всех холодные. Основной рельеф — лед или вечная мерзлота. У экватора может быть теплее. Земной, Маргинальный: мир, едва способный поддерживать жизнь. Часто встречается в разреженной атмосфере и небольшом количестве воды. Первичная местность часто бывает жаркой или замороженной пустыней. Может поддерживать примитивные экосистемы. Земной, океанический: мир, способный поддерживать жизнь. Поверхность этого мира покрыта водой, возможно, с отдельными островами.Земной, Рай: земной мир, способный поддерживать жизнь. Многочисленные биомы поддерживают широкий ассортимент флоры и животных. Земной, редуцирующий: мир, не способный поддерживать жизнь в том виде, в каком мы его знаем. Хлор, фтор и другие химически активные газы составляют атмосферу, а кислоты составляют большую часть гидросферы. Хотя эти газы смертельны для жизни на Земле, они, как и кислород, могут поддерживать экзотические формы жизни. Наземный, Ультра Враждебный: Иногда называют «Миры Демонов». Как Terrestrial Hostile, но гораздо более адски.Непригоден для жизни, какой мы ее знаем, по ряду причин. Часто встречается в плотной атмосфере, содержащей ядовитые газы, при экстремальном давлении и температуре. 17 Грязный снежок: замороженный мир на внешней границе звездной системы, состоящий из горных пород и льда, состоящего из воды и углекислого газа. Непригоден для жизни, какой мы ее знаем. Ледяной мир: замороженный мир на внешней границе звездной системы, состоящей из льда, состоящего из воды и двуокиси углерода. Приливные силы или тепло от небольшого скалистого ядра могут нагреть лед ниже ледяной поверхности на много миль глубиной, что приведет к образованию больших подповерхностных океанов.Возможно, эти океаны изобилуют жизнью, которая развивалась в условиях, очень похожих на наши морские глубины. Хтониан: Планета, возникшая в результате разрушения атмосферы газового гиганта, часто из-за близости к звезде. Вся планета может быть остатками металлического ядра. В некоторых случаях это могло быть углеродное ядро ​​под экстремальным давлением, представьте себе, алмазная планета! Экзотика: мир, не попадающий ни в одну другую категорию. . Миры из чистого железа или твердого углерода, возможно, найденные вокруг массивных звезд.Планеты, состоящие из чистой воды или тяжелых плотных газов, таких как окись углерода. Другие возможности включают экзотические геологические структуры или атмосферы. Электрически заряженные миры с экстремальными магнитными полями и т. Д. Газовые гиганты: большая планета, иногда называемая миром Юпитера, которая в основном состоит из газообразного водорода с различным количеством других газов, таких как гелий и метан. Горячие газовые гиганты: газовые гиганты, обнаруженные во внутренней системе, вращающейся близко к своей родительской звезде. Считается, что гиганты горячего газа образуются на расстоянии от звезды во внешней системе, где планета может образовываться из горных пород, льда и газов.Затем планеты перемещаются внутрь к Солнцу, где в конечном итоге формируют стабильную орбиту. Миграция обычно происходит на ранней стадии формирования звездная система. Атмосфера горячих газовых гигантов может содержать большое количество окиси углерода, щелочных металлов и силикатных облаков. Через некоторое время солнечные ветры могут унести атмосферу и внешние слои гигантов из горячего газа. Их оставшиеся ядра могут стать хтоническими планетами. Потеря внешних слоев зависит от размера и материала планеты, а также от расстояния до звезды.В типичной системе газовый гигант, вращающийся на 0,02 а.е. вокруг своей родительской звезды, теряет 5-7% своей массы за время своей жизни, но вращение ближе, чем 0,015 а.е., может означать испарение всей планеты, за исключением ее ядра. Коричневый карлик: субзвездные объекты, у которых их масса ниже массы, необходимой для поддержания реакций ядерного синтеза с сжиганием водорода в их ядрах, как и звезды на главной последовательности, но которые имеют полностью конвективные поверхности и внутренности, без химической дифференциации по глубине. . Коричневые карлики занимают диапазон масс между большими газовыми планетами-гигантами и звездами с наименьшими массами; этот верхний предел составляет от 75 до 80 масс Юпитера. 18 Мировая классификация Империум По желанию.Определить классификацию Империума. Используйте их для обитаемых миров Империума. Эти описания могут помочь вам в создании планеты. 1. Определите мировую классификацию 1 д 100 1–20 21–40 Империум мирового класса Агро-мир Цивилизованный мир Развивающийся мир Мертвый мир Смерть мир Дикий мир 1 д 100 56 — 60 Империум мирового класса Feral World Feudal World Forge World Улей Мир Карантин Мир Святынь 61 — 66 41–45 67 — 77 46–50 51–55 56–60 78– 96 97 98–100 Помимо типа планеты, Адептус Терра также классифицирует мир по его основному использованию для сбора десятины.Эти условия применяются, за некоторыми исключениями, к обитаемым имперским мирам. Agri-World: Agri-world — это мир, посвященный производству продуктов питания. Большая часть его поверхности занята производством пищи для других миров, зависящих от такого импорта — сама пища составляет часть требуемой для планеты десятины. Адептус Терра требует, чтобы губернаторы таких планет охраняли урожай и соблюдали установленные на них квоты. Миры с 850 частями на 1000 поверхности планеты, покрытые земледелием, гидропоникой, кормом для животных или животноводством, классифицируются как миры арги.Население обычно колеблется от 15 000 до 1 000 000, что широко распространено по всей планете. Цивилизованный мир: Из всех типов поселений в Империуме цивилизованные миры являются наиболее распространенными (хотя термин «цивилизованный» здесь относится к их городским ландшафтам, а не к какой-либо претензии на социальное приличие). В достаточном количестве миров основными населенными пунктами, как правило, являются большие города или другие городские районы, которые поддерживаются собственным сельскохозяйственным производством планеты.Состояние развития как в технологическом, так и в социальном плане варьируется, но чаще всего находится в районе нынешних имперских норм. Большинство адъюнктов Имперского государства обычно присутствуют на планете1. Согласно руководящим принципам классификации, цивилизованный мир имеет население от 15 000 000 до 10 000 000 000 и платит десятину между Solutio Extremis и Exactis Tertius. Развивающиеся миры: эти миры разделены на географические области с очень разными уровнями развития и культуры. В зависимости от преобладающих правительств это могут быть страны, штаты, блоки власти или родовые земли.Может случиться так, что более высокие уровни технологий и богатства сосредоточены вокруг первоначальных мест колонизации. Культура других планет может сильно отличаться из-за окружающей среды, при этом области, в которых не хватает природных ресурсов, также слабы. 19 с точки зрения военной мощи, экономической мощи и так далее. Некоторые планеты сохраняют большой разрыв из-за табу древних племен, религиозных представлений или простых старомодных привычек. Множество миров Империума подпадают под эту широкую категорию, но нет двух одинаковых в том, как они осознают эти различия.Dead Worlds: A Dead World — это безвоздушный и полностью стерильный мир, полностью лишенный атмосферы, экосистемы и естественной естественной жизни, и непригодный для их поддержки. За исключением, возможно, имперских объектов, таких как исследовательские станции, базирующиеся на планете, в остальном ее население отсутствует. Большинство таких планет всегда были мертвыми мирами; другие изначально были обитаемыми мирами, пониженными до статуса мертвого мира в результате апокалиптических событий, таких как exterminatus, потребление тиранидов и разрушительная междоусобная война.Мир смерти: Мир смерти — это планета, на которой местная флора и фауна превратились в агрессивные и опасные формы. Эти экосистемы прекрасно сбалансированы между непрерывным разрушением и молниеносным воспроизводством. Миры смерти принимают разные формы: от покрытых джунглями адских дыр с хищными растениями и животными до бесплодных вулканических пустошей, раздираемых ионными штормами. Люди могут жить и живут в этих мирах, но это бесконечная борьба. Во многих мирах смерти это выглядит так, как если бы вся биомасса планеты была сознательно настроена против поселения людей — концентрируя силы против злоумышленников, чтобы уничтожить их.Миры смерти с человеческими поселениями или колониями могут иметь население от 1 000 до 15 000 000 человек. Дикий мир: эти миры населены племенными народами, в основном живущими без помощи поддерживаемых технологий. Это может быть связано с провалом проекта колонизации, религиозными предпочтениями, культурным выбором, окружающей средой или какой-либо другой причиной. Они могут быть осведомлены об Империуме каким-то образом, но вряд ли будут знать больше, чем что-то о большой группе далеких людей, живущих среди звезд. Эти планеты часто непригодны для последующей колонизации либо из-за обстоятельств, сделавших туземцев дикими, либо из-за того, что сами аборигены активно сопротивляются новым людям, поселяющимся на их землях.Люди диких миров могут иметь самые разные культуры: от охотящихся на гроксов племен поклонников предков до безумных постапокалиптических дорожных воинов, бесконечно сражающихся среди ядовитых, усыпанных песком руин своей цивилизации. Феодальный мир: эти планеты населены людьми, которые потеряли доступ ко всем технологиям, кроме самых элементарных. Известно сельское хозяйство, простые машины, такие как шкивы, ветряные мельницы и т.п., но летательные аппараты, автоматическое вооружение и даже транспортные средства с приводом, вероятно, будут редкостью или вообще отсутствовать.Эти миры часто называют наиболее политически гармоничными из всех планет Империума, потому что их народы знают свое место. Мир-кузница: Большая часть мира-кузницы похожа на огромную фабрику с промышленными комплексами, взмывающими в небо, и шахтами, зарывающимися глубоко в корку. Миры-кузницы создают огромное количество сложных машин, таких как танки или детали космических кораблей. Ими правит Адептус Механикус, чьи учебные и исследовательские центры расположены там, наряду с величественными соборами их божества, Омниссии, в которых архимаги техножрецов проводят самые грандиозные и сложные ритуалы в честь бога машин. .Флот Адептус Механикус, его армии технической гвардии и, что наиболее грозно, Легионы Титанов, также основаны на мирах-кузницах. Миры-кузницы являются суверенной землей, и Адептус Механикус не желает допускать кого-либо на свою поверхность, кроме техножрецов и легионов слуг, которые служат им. Мир-улей: в Империуме тысячи миров-ульев. Большинство из них состоит из различных замкнутых городов-ульев или кластеров-ульев, окруженных пустошами, джунглями, льдом, равнинами и т. Д. В самых экстремальных примерах мир-улей развился за пределы отдельных кластеров-ульев, где поверхность планеты полностью урбанизирована с сотнями сложенные слои аркологий, покрывающие всю планету.Святая Терра — пример этого «города-планеты». Население огромно, и почти все продукты питания нужно импортировать. Мир-улей, временно недоступный в варп-пространстве, за очень короткое время столкнется с опустошающим голодом. . Миллиарды людей могут жить вместе в одном городе-улье. Как и большинство других имперских миров, в обществе мира-улья есть отдельные классы: правящий класс и рабочий класс. Низшие классы неизменно населяют нижние, более разложившиеся и загрязненные уровни Улья.Огромное количество рабочих в Улье затрудняет их контроль. Банды растут и контролируют секции, дерутся между собой, а миллионы живут на обрезках. Далее мощность достигает древней системы освещения, а еще выше — системы циркуляции воздуха, очищающие воздух для тех, кто достаточно богат, чтобы себе это позволить. Это иерархическая система и безжалостная, но с учетом достаточной 20 Если есть силы сдерживать рост населения, это очень эффективный способ размещения миллиардов людей. Если бы у каждого человека был дом на земле, вся планета была бы наводнена жилыми помещениями и не имела бы места для производственных помещений.Миры-улья важны из-за своей производительности. Они даже близко не достигают производства Мира-кузницы, но количество рабочих выдает огромное количество материалов. Жители Улья Мира, такие же жестокие и свирепые, как и обитатели Дикого мира, также обеспечивают Империум одним из лучших боевых материалов. Карантинные миры: существование этих планет редко становится очевидным, но их много по всему Империуму. Путешествие в эти миры часто запрещено, за исключением самых хорошо информированных и хорошо вооруженных экспедиций, да и то только по очень уважительной причине.Миры смерти, инопланетные империи или планеты, где существа варпа прорвались в реальное пространство, — все это примеры изолированных миров, как и планеты, пораженные чумой. Некоторые миры помещены в карантин, потому что никто не может понять происхождение того, что там было найдено, будь то таинственные артефакты или древние города — считается, что лучше жить в неведении о том, что находится в таких мирах, чем рисковать тем, что это может стать угрозой. Миры-святилища: иногда используется в сочетании с другой мировой классификацией, т.е.е .; Agri-World / Shrine World, в этих мирах преобладают религия и религиозные обряды. Возможно, в этих местах родился знаменитый святой или они стали полем битвы для особо важной войны. Эти миры, часто усеянные храмами и святынями, часто контролируются Экклезиархией и могут служить тренировочными площадками для членов их боевых зон Адепта: в Империуме очень много миров, которые можно классифицировать как зоны боевых действий. Империум постоянно находится в состоянии войны, и в этих войнах могут сгореть целые планеты.Массовые кампании могут охватывать десятки систем и сотни миров, многие из которых полностью опустошены орбитальными бомбардировками и артиллерией в масштабных битвах, которые длились десятилетия. Зоны долгосрочных боевых действий — это адские места, где смерть наступает быстро. Империум может выставить поистине огромные армии из миллионов человек, прокладывая себе путь через опустошенную планету и превращая города в руины. Наемники стекаются в такие места, надеясь вскоре уйти со своими кораблями, загруженными жалованьем. Дезертиры и сбежавшие пленные образуют банды пиратов, охотясь на любые корабли. не в состоянии защитить себя или бродить по истерзанным войной планетам в диких стаях, крадущих и убивающих.Администратум посылает колонистов из переполненных миров заселять истерзанные войной миры после того, как битва закончилась, но колеса Империума крутятся медленно, и мир может лежать опустошенным веками, прежде чем будут предприняты какие-либо усилия по его заселению. Эти места могут быть одними из самых ужасных в Империуме, с разоренной окружающей средой, потрескавшимися планетными корками, выжженными городами и равнинами, покрытыми костями павших. Xeno World: миры Xeno — нечеловеческие и неимперские миры, населенные инопланетными расами.Человечество — лишь одна из многих рас в галактике, но ни одна из них не так широко и не так многочисленна, как люди. Большинство инопланетных рас населяют только один мир или небольшую группу миров. Большинство инопланетян сравнительно примитивны, мирны или бессильны и мало интересуют человечество. Лишь несколько инопланетных рас сильны, агрессивны и обладают технологиями, которые не уступают технологиям Империума. Из них наиболее распространены орки, эльдары, тираниды и тау. 21 год Индекс планетарного класса Класс Пример подкласса Средн.Диаметр (1000 км) Основной Типичная зона атмосферы системы Ни один Описание Пустая орбита Никто Никакой мир, астероид или другое тело не присутствуют. Очень маленькие каменистые или металлические тела, занимающие эту орбиту. Очень горячий мир. Частично до полностью расплавленной поверхности. Часто очень молодой и новообразованный мир обнаруживается во вновь формирующихся звездных системах. Геологически очень активен. Сильное внутреннее тепло, возможно, от высокорадиоактивного ядра или приливных сил. Также известны как карликовые планеты. Маленькие каменистые или ледяные тела. Маленький каменистый мир или луна.Обычно геологически неактивный. Возможно, в этом мире когда-то была жизнь, а могло и не быть. Теперь жизнь в том виде, в каком мы ее знаем, невозможна по ряду причин. Менее 10% гидросферы. Чрезвычайно сухой, естественных осадков практически нет. Может быть обитаемым. По крайней мере, 80% криосферы Едва пригодна для жизни. Враждебная / примитивная экосистема. Гидросфера более 90%. Разнообразие биомов. Часто процветает обширный растительный и животный мир Пояс астероидов

% PDF-1.4 % 1 0 объект > эндобдж 5 0 obj > эндобдж 2 0 obj > поток 2017-07-14T18: 45: 48 + 06: 30Canon iR-ADV C5535 PDF2017-07-14T19: 50: 14 + 06: 302017-07-14T19: 50: 14 + 06: 30Adobe PSL 1.3e для Canonapplication / pdfuuid: f6b56859-0000-4142-4344-454600000000uuid: 7348e1b3-1d46-413f-a363-807e17ce4d6d конечный поток эндобдж 3 0 obj > эндобдж 4 0 объект > эндобдж 6 0 obj > поток HyTSw oɞc [5laQIBHADED2mtFOE.c} 08 ׎8 GNg9w ߽

Модель нефтяного рынка — Nems Часть 1 | НПЗ

Вы читаете бесплатный превью
Страницы с 8 по 13 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страница 17 не отображается в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 21 по 40 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 44 по 45 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 49 по 50 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 58 по 63 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 67 по 77 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 84 по 94 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы 102–104 не отображаются в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 117 по 127 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 136 по 181 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 190 по 205 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Страницы с 214 по 216 не показаны в этом предварительном просмотре.

Вы читаете бесплатный превью
Page 225 не отображается в этом предварительном просмотре.

10.indd

% PDF-1.3 % 1 0 объект >] / PageLabels 6 0 R / Pages 3 0 R / Type / Catalog / ViewerPreferences >>> эндобдж 2 0 obj > поток 2019-05-31T14: 16: 17-03: 002019-05-31T14: 16: 19-03: 002019-05-31T14: 16: 19-03: 00 Adobe InDesign CC 2017 (Windows) uuid: 760da8a6-bdbc-49a6 -8bf2-0e54ae0b0a8dxmp.сделал: A4932A364A08E411B13CC5EC89010A7Bxmp.id: 58ec881f-a160-6b45-9394-d3facb2eef85proof: pdf1xmp.iid: 8bf4972e-65fb-ed41-8a41-fd81dcc6a328xmp.did: dc34d500-3de9-dd4e-9afa-e3b20183e848xmp.did: A4932A364A08E411B13CC5EC89010A7Bdefault

  • convertedfrom применение / х -indesign в приложение / pdfAdobe InDesign CC 2017 (Windows) / 2019-05-31T14: 16: 17-03: 00
  • application / pdf
  • 10.indd
  • Библиотека Adobe PDF 15.0FalsePDF / X-1: 2001PDF / X-1: 2001PDF / X-1a: 2001 конечный поток эндобдж 6 0 obj > эндобдж 3 0 obj > эндобдж 8 0 объект > эндобдж 9 0 объект > эндобдж 10 0 obj > эндобдж 21 0 объект > / Font> / ProcSet [/ PDF / Text] / XObject >>> / TrimBox [0.0 0,0 595,276 841,89] / Тип / Страница >> эндобдж 22 0 объект > / Font> / ProcSet [/ PDF / Text] / XObject >>> / TrimBox [0.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *