Содержание

Обострение. Шизофрения по наследству › Новости Санкт-Петербурга › MR-7.ru

Душевные заболевания пугают нас не меньше, чем физические. Пугают в том числе своей загадочностью. Мы не видим, как они развиваются ни внешне, ни на рентгенах. Отсюда множество мифов и страшилок. Одна из них — про наследственность. Может ли шизофрения передаваться на генетическом уровне — об этом рассказывает президент Общероссийской общественной организации инвалидов, потребителей психиатрической помощи и их семей «Новые возможности» Алексей Гегер.

Фото: Алексей Гегер

— Часто к нам обращаются с тревожными вопросами: дескать, «недавно узнали: дед болел шизофренией, а вот теперь у нас родился сын, он же точно заболеет? Ведь это все передаётся по мужской линии через поколение?» Молодые мамы очень часто тревожны сами по себе после рождения первенца, а здесь ещё внезапно, как «снег на голову», известия о некоем заболевании деда 40 лет назад или двоюродного дяди. Есть повод встревожиться. Тем более, когда ничего не знаешь толком об этих загадочных «проблемах с головой».

Молодые родители решают действовать во что бы то ни стало. И часто попадают в руки шарлатанов от психиатрии. Эти психологи и коучи в надежде заработать начинают подогревать тревожность молодых мам и пап.

Так как, как говорится, «клиент созрел» и намерен платить ещё и ещё. Такие специалисты иногда советуют довольно странные вещи: например, пропить двухнедельный курс нейролептиков трехлетнему ребёнку «для профилактики». Нейролептиков довольно тяжёлых, которыми снимаются острые состояния.

Во-первых, такие лекарства для профилактики не принимают, а во-вторых, за две недели едва ли концентрация препаратов достигнет необходимого уровня. К чему может привести такой эксперимент? Вы только напрасно измучаете маленького ребёнка.

Если же говорить о наследственности психических заболеваний, то здесь нет стопроцентной зависимости между болезнями предков и возможным заболеванием потомков. Важно помнить одно: лучше отбросить тревожность и бросить все усилия на создание спокойного микроклимата дома — именно это залог душевного здоровья ваших детей. Все просто: не тревожится мать — спокоен ребёнок.

Согласно последним научным исследованиям, генетический фактор не является решающим в развитии тяжелых психических расстройств. Так, выявлено, что наследственность вносит вклад в развитие заболевания только в 30% случаев и то не всегда. При этом…

…в патогенезе шизофрении ведущая роль отдается именно социальному фактору, но никак не генетическому.

Более того, ни ген, ни совокупность генов, которые отвечают за развитие шизофрении не обнаружены, к тому же вероятные генетические маркеры встречаются у крайне малого количества больных.

Вероятность передачи шизофрении от отца не превышает 3,1%, а от матери — не превышает 14%.

Другими словами, наследование тяжелых психических расстройств — своего рода «лотерея». С таким же успехом можно волноваться о падении кирпича с крыши на голову по дороге на работу.

Желаю вам спокойствия и только спокойствия, как говорил один известный герой. Также желаю хорошей погоды и «холодной» головы. Непременно.

Как дети вступают в наследство?

Родителям детей-наследников – о том, что нужно для вступления в наследство и почему могут отказать; кто должен сообщить о нем и что будет, если не сообщат; как имущество будет делиться между родственниками и можно ли отказаться от наследства

Наследство от неизвестного дядюшки-миллионера – тайная мечта многих. Но в реальности большинство получают имущество от умерших близких людей. Боль от утраты родного человека смешивается с прохождением бюрократических процедур. Особенно сложно в ситуациях, когда наследником является несовершеннолетний, хотя, на первый взгляд, никаких особенностей положения разд. V Гражданского кодекса, посвященного наследственному праву, не содержат.

Что нужно для вступления в наследство?

Для вступления в наследство заявителю необходимо представить нотариусу следующие документы:

  • заявление о вступлении в наследство;
  • свидетельство о смерти;
  • документ, подтверждающий личность;
  • документы, доказывающие право человека на наследство; к ним в зависимости от обстоятельств могут относиться: завещание, свидетельство о рождении, свидетельство о заключении брака и иные документы, подтверждающие родственные отношения.

Такой пакет бумаг представляет любой, кто претендует на наследство. Дети не исключение.

Нужен ли представитель для вступления ребенка в наследство?

От имени детей действуют их родители или опекуны. Это обусловлено тем, что ребенок ограничен в дееспособности. При этом Гражданский кодекс разделяет детей на две группы: малолетние (до 14 лет) и несовершеннолетние (от 14 до 18 лет). Они обладают разным объемом дееспособности.

Любые юридические действия за малолетних совершают их родители или опекуны. Поэтому, например, 13-летний ребенок не может сам подать заявление о вступлении в наследство.

Несовершеннолетние совершают сделки с письменного согласия законных представителей (ч. 1 ст. 26 ГК РФ). Это значит, что самостоятельно несовершеннолетний не вправе открыть наследственное дело. Заявление будет подаваться от его имени за его подписью, но с согласия родителей или опекунов. Данная позиция подтверждается судебной практикой. Например, суд указал, что несовершеннолетняя К. не могла полностью осознавать значимость установленных законом требований о необходимости своевременного принятия наследства и была неправомочна самостоятельно подать нотариусу заявление о принятии наследства, поскольку за нее эти действия в силу ст. 64 Семейного кодекса осуществляет ее законный представитель или же он дает на это согласие (п. 4 Обзора судебной практики Верховного Суда РФ за четвертый квартал 2013 г.).

Однако из этого правила есть исключения: подростки, вступившие в брак (ст. 21 ГК РФ), и эмансипированные подростки, которые работают по трудовому договору или занимаются предпринимательской деятельностью (ст. 27 ГК РФ). Они считаются полностью дееспособными и сами заключают любые сделки, в том числе вступают в наследство. При этом эмансипация возможна только с 16-летнего возраста. Что касается возраста вступления в брак, то Семейный кодекс дал регионам карт-бланш на самостоятельное установление нижних возрастных границ при наличии особых обстоятельств. Например, в Чеченской Республике и Адыгее возможно заключение брака с 14 лет. Такие подростки при вступлении в наследство должны доказать нотариусу свою дееспособность, представив свидетельство о заключении брака, решение об эмансипации.

Должен ли представитель ребенка подтверждать свой статус?

При вступлении несовершеннолетнего в наследство его законный представитель должен подтвердить свой статус (п. 5.9 Методических рекомендаций по удостоверению доверенностей, утвержденных Решением Правления Федеральной нотариальной палаты от 18 июля 2016 г., протокол № 07/16). Для этого он представляет нотариусу:

  • свой паспорт;
  • свидетельство о рождении ребенка, в котором представитель указан в качестве отца или матери;
  • решение о назначении опекуном (при наличии).

Последний документ оформляется на детей, оставшихся без попечения родителей. Это могут быть как сироты, так и несовершеннолетние, которых бросили родители. Родственник, желающий заботиться о ребенке, обращается в органы опеки. Его назначают опекуном и выдают соответствующее решение.

Если представитель несовершеннолетнего не представит перечисленные документы, нотариус вправе будет отказать ребенку во вступлении в наследство на основании ст. 48 Основ законодательства РФ о нотариате.

Если ребенок помещен в детский дом, все обязанности, которые возлагаются на родителей и опекунов в связи со вступлением детей в наследство, должны исполняться администрацией этого учреждения. Поэтому нотариусу нужно будет представить решение о помещении ребенка в детский дом, доверенность от имени администрации детдома и т.д.

Кто сообщит о наследстве родственникам, которые о нем не знают?

Ни методические рекомендации нотариальной палаты, ни Закон о нотариате не возлагают на нотариуса обязанность по розыску наследников. Статья 61 Основ законодательства РФ о нотариате устанавливает, что нотариус обязан лишь известить наследников, о которых ему известно. Поэтому обычно работники нотариальных контор спрашивают у заявителей о других наследниках, и на этом их мероприятия по определению круга лиц, призываемых к наследству, ограничиваются.

Извещение тоже осуществляется формально. В кино можно увидеть, как нотариусы лично приезжают к наследникам и сообщают им о свалившемся на них богатстве. Реальность другая. Если нотариус знает место жительства или работы наследника, он отправит письмо. Оно потерялось или не дошло? Это проблемы наследника. А если сведений об адресе нет, нотариус разместит на сайте Федеральной нотариальной палаты информацию о вызове наследника. Человек никогда не слышал о таком сайте и тем более не заходит на него? Ему просто не повезло. Никаких дополнительных мер по розыску нотариус принимать не будет.

Обратите внимание, что сроки принятия наследства указаны в ст. 1154 ГК РФ. Общий срок – 6 месяцев со дня открытия наследства, т.е. со дня смерти наследодателя. В этой же статье предусмотрены и специальные сроки принятия наследства. А теперь представим такую ситуацию: наследник не подал заявление вовремя, только потому что не знал о смерти родственника. Восстановят ли сроки подачи заявления? Нет, если не будет иных причин пропуска сроков, например болезнь, малолетний возраст и т.д. (определение Первого кассационного суда общей юрисдикции от 29 октября 2020 г. № 88-24674/2020).

Как имущество будет делиться между наследниками?

Иногда по завещанию наследуется только часть имущества. Тогда наследнику по завещанию передается оставленное ему имущество, а остальное делится между всеми наследниками по закону. Например, у покойного были квартира, дача и автомобиль. Наследниками по закону являются жена, сын и родители. Наследодатель в завещании указал, что после его смерти квартира должна достаться ребенку, а про остальное имущество не упомянул. В этом случае наследство будет делиться так: квартира отойдет сыну, дача и автомобиль будут поделены между всеми наследниками поровну.

Если делить нечего, наследники по закону не получают ничего. Используем тот же пример, только на этот раз предположим, что дача и автомобиль были проданы при жизни наследодателя. Сын получит квартиру, а остальные наследники ничего не получат.

Если есть наследники обязательной доли, их часть будет передана из незавещанного имущества. Если этого не хватит, «отщипнут» от того, что перешло по завещанию (ст. 1149 ГК РФ). Например, родители покойного – пенсионеры. Это дает им право претендовать на обязательную долю наследства (половину от того, что они получили бы по закону). Поэтому если кроме квартиры ничего нет, она будет делиться между сыном и его бабушкой с дедушкой.

Могут ли родители распоряжаться наследственным имуществом ребенка?

Хотя Гражданский кодекс устанавливает, что несовершеннолетние обладают частичной дееспособностью, он не ограничивает их права на владение имуществом. Если ребенок вступает в наследство, независимо от его возраста имущество будет зарегистрировано на его имя. Часто взрослые не до конца понимают, что это значит, и считают имущество ребенка своим. Это не так. Родители и опекуны могут распоряжаться наследством только в ограниченном объеме.

Допустим, малолетний получил квартиру и автомобиль. Продать их можно, только если взамен будет приобретено другое имущество, которое по своим характеристикам не уступает проданному. И на такие сделки потребуется согласие органов опеки, которые будут оценивать, соответствует ли договор интересам ребенка. Например, можно продать автомобиль и купить новую машину, которая также будет зарегистрирована на ребенка. А вот продать авто и потратить деньги на ремонт в своей квартире уже не выйдет. Причем до совершеннолетия ребенка родителям придется без какого-либо возмещения содержать наследственное имущество, например проходить техосмотр, оплачивать жилищно-коммунальные услуги и т.д. (п. 28 Постановления Пленума Верховного Суда РФ от 27 июня 2017 г. № 22). Так, если мать 10 лет платила за квартиру сына, она тем самым не приобретет права на нее.

Неудивительно, что у родителей может возникнуть идея отказаться от наследства, пока ребенок сам не может выражать свою волю.

Можно ли отказаться от наследства от имени ребенка?

Такой отказ возможен только с разрешения органа опеки и попечительства. Иногда от наследства и правда выгоднее отказаться, ведь вместе с имуществом наследуются долги покойного (подробнее от этом – в статье «Если в наследство получили долги…»). Но такое решение может быть продиктовано и эгоистичными соображениями опекуна, особенно если он сам является наследником. Органы опеки оценят, действительно ли отказ от вступления в наследство в интересах ребенка, и только после этого согласуют его или нет.

Более того, если родители или опекуны не обратятся к нотариусу с заявлением о вступлении в наследство, орган опеки в судебном порядке потребует признать детей наследниками и выделить им долю. Такой пример: родители детей погибли. От отца осталась добрачная квартира. Дедушка и бабушка, назначенные опекунами малолетних, «забыли» сообщить о них нотариусу при вступлении в наследство. Узнав об этом, управление социальной защиты населения обратилось в суд и потребовало признать за детьми доли в квартире. Суд с требованиями органа соцзащиты согласился (Апелляционное определение Московского городского суда от 16 ноября 2017 г. по делу № 33-47091/2017).

Почему несовершеннолетнему могут отказать во вступлении в наследство?

Действующее законодательство не предоставляет детям значимых преференций при оформлении наследственных прав. А значит, нотариус может отказать несовершеннолетнему во вступлении в наследство по тем же причинам, что и взрослому. Обычно такое случается, если пропущены сроки принятия наследства (они установлены в ст. 1154 ГК РФ), не представлены нужные документы или они некорректно оформлены. По запросу заявителя отказ оформляется в письменном виде, где указываются причины такого решения. Если гражданин не согласен с выводами нотариуса, он вправе обратиться в суд.

Чаще в наследство вступают по закону на основании родственных связей с умершим. Вместе с тем ст. 47 Семейного кодекса устанавливает, что права детей основываются на их происхождении, удостоверенном в установленном законом порядке. Иными словами, если мать и отец ребенка не вписаны в свидетельство о рождении, с точки зрения закона родителями они не являются, а значит, никаких прав и обязанностей у них перед ребенком не возникает, в том числе и наследственных.

Более того, будет крайне затруднительно подать нотариусу заявление, ведь вместе с ним нужно предоставить свидетельство о смерти. Предположим, мать ребенка погибла. Если она и отец ребенка состояли в браке, получить этот документ может супруг. Если же они были сожителями, государственные органы свидетельство о смерти женщины не выдадут, поскольку будет считаться, что мужчина и ребенок никакого отношения к покойной не имеют (Приказ Минюста России от 28 декабря 2018 г. № 307).

Таким образом, если в свидетельстве о рождении ребенка в графе мать стоит прочерк, к наследству малолетний призван не будет, пока не будет установлено материнство. Обычно происхождение ребенка от конкретной женщины не вызывает вопросов, поскольку подтверждается медицинской документацией. Ее и используют при регистрации рождения детей. Но если ребенок родился вне медучреждения, таких документов может не оказаться. Кроме того, иногда женщина рожает без документов, а потом оставляет ребенка в роддоме. Тогда факт рождения будет зарегистрирован, а вот ее материнство – нет. Верховный Суд РФ указал, что в таком случае материнство устанавливается так же, как и отцовство, – в судебном порядке.

Законодательство предусматривает две процедуры: установление факта материнства и подача иска об установлении материнства.

В первом случае подается заявление об установлении факта, имеющего юридическое значение. Это возможно, если соблюдены два условия:

  • между сторонами нет спора о происхождении ребенка, т.е. все согласны, что его родила именно эта женщина;
  • рождение ребенка не зарегистрировано в ЗАГСе.

Если хотя бы одно из этих условий не соблюдено, необходимо будет подать исковое заявление.

В обоих случаях заявителю придется доказывать свою позицию. Для этого могут потребоваться медицинские документы и свидетели, которые присутствовали при рождении ребенка (при наличии). По делам такого рода может быть назначена генетическая экспертиза. В случае смерти матери ДНК ребенка сравнивается с ДНК ее родственников. При необходимости может быть проведена эксгумация.

После судебного разбирательства орган ЗАГС внесет изменения в свидетельство о рождении ребенка, а затем второй родитель как законный представитель сможет получить свидетельство о смерти матери ребенка. Этот документ потребуется при вступлении в наследство не только по закону, но и по завещанию, ведь иначе невозможно будет доказать, что можно открыть наследственное дело.

Можно ли оспорить завещание?

Как и любую сделку, завещание можно оспорить. Как правило, человек, несогласный с волей наследодателя, ссылается на то, что он был недееспособен в момент оформления завещания. Однако такие дела часто оканчиваются отказом в удовлетворении иска.

Срок давности по оспариванию завещания составляет год с момента, когда заинтересованная сторона о нем узнала или должна была узнать. Для несовершеннолетнего годичный период будет отсчитываться с момента, когда он достиг 18 лет. Например, когда ребенку было 15 лет, его мать вступила в наследство, проигнорировав завещание отца. Срок давности для ребенка истечет, когда ему исполнится 19. Это обусловлено тем, что несовершеннолетний не может в полном объеме реализовать свои права, поэтому для него срок будет отсчитываться с того момента, когда он стал полностью дееспособным (Апелляционное определение Московского городского суда от 6 марта 2017 г. по делу № 33-8377/2017).

Что передается по наследству?

Вся информация о человеке — его внешности, характере, талантах и склонностях — заключена в нити ДНК, которая присутствует в ядре каждой клетки организма. Данные закодированы в 46 хромосомах: от отца и матери человек получает в наследство по 23 хромосомы. Они содержат 50 000–100 000 генов, определяющих такие особенности человека, как цвет кожи, глаз, волос, характер и т. д.

Что и как передается по наследству?

Большинство генов обладает двумя вариациями, называемыми аллелями, которые могут быть доминантными и рецессивными. Если в паре оказываются разные гены, то один из них «побеждает». Он называется доминантным, тогда как «подавленный» ген носит имя рецессивного. Когда и у отца, и у матери имеется рецессивный ген, тогда он не только передается по наследству ребенку, но и проявляется у него.

Доминантными считаются гены, отвечающие:
  • за темный цвет глаз;
  • темные жесткие вьющиеся волосы;
  • полные губы;
  • смуглую кожу;
  • большой нос с горбинкой;
  • широкий подбородок.

Рецессивные гены, передающиеся по наследству, несут в себе такие особенности внешности, как:
  • светлые глаза;
  • светлые мягкие прямые волосы;
  • тонкие губы;
  • светлая кожа;
  • узкий нос с маленькими ноздрями;
  • узкий подбородок.

Например, светлый цвет глаз является мутацией гена OCA2, синий и зеленый оттенок обеспечивает ген EYCL1 хромосомы 19, карий — EYCL2. В целом, цвет глаз определяют такие гены, как OCA2, SLC24A4, TYR.

Мы подготовили для Вас список исследований, которые помогут разобраться с данной проблемой:

5 рабочиx дней

Анализ полиморфизмов в генах фолатного цикла

4900 ₽

Подробнее

10 рабочиx дней

Скрининг на носительство наследственных заболеваний «Базовый»

7000 ₽

Подробнее

45 рабочиx дней

Скрининг на наследственные заболевания «Экспертный»

30000 ₽

Подробнее

Черты характера и привычки, передающиеся по наследству

Гены, полученные от родителей, определяют не только внешность ребенка. Ученые считают, что интеллектуальные способности также могут передаваться по наследству. Конечно же, в этом играют большую роль воспитание и обучение ребенка. Художественный вкус, творческие способности, музыкальность и другие качества также переходят от родителей к детям. Что еще передается по наследству: темперамент, мимика, тембр голоса.

К сожалению, наследование касается не только положительных черт характера. Считается, что в наследство от папы и мамы малыш может получить склонность к алкоголизму, агрессии, фобиям, страхам, суицидальным наклонностям. Правильное воспитание, благоприятная атмосфера, в которой растет ребенок, и забота родителей позволяют нивелировать генетические склонности негативного характера.

Здоровье «по наследству»

Описано более 3500 заболеваний человека, обусловленных наследственностью. Ученым известны конкретные гены, «виновные» в развитии болезни, их мутации и типы нарушений, ведущих к развитию патологии. От родителей наследуются: дальтонизм, сахарный диабет первого типа, витилиго, наследственная кардиомиопатия, фенилкетонурия, бронхиальная астма, муковисцидоз, шизофрения и т. д. Наследственность определяет обмен веществ человека, особенности работы иммунной системы, уровень стрессоустойчивости и т. д.

Как узнать, что передается по наследству?

Современная наука и медицина позволяют получить информацию о генетическом наборе любого человека. Это означает, что родители могут заранее узнать, какие гены они могут передать по наследству своему ребенку. Особенно это касается генетических заболеваний и отклонений.

Кариотипирование — исследование, в ходе которого составляется карта хромосом человека. Она позволяет обнаружить перестройки и аномалии в хромосомном наборе родителей, которые могут передаться ребенку. Когда пара знает, что может передаваться по наследству, то более ответственно подходит к вопросу планирования беременности. Зная о рисках, будущая мама с готовностью проходит дородовой скрининг, чтобы убедиться в отсутствии аномалий и генетических нарушений у будущего ребенка.

В медико-генетическом центре «Геномед» проводится кариотипирование и другие исследования хромосомного набора родителей и будущего малыша. В центре также можно пройти неинвазивную и инвазивную пренатальную диагностику плода.

передаются ли психические заболевания по наследству

Передаются ли психические заболевания по наследству? Этот вопрос волнует многих родителей. Ведь очень страшно «наградить» своего ребенка расстройством психики.

Как передаются психические болезни

То, что психические заболевания могут передаваться по наследству, замечено было давно. Сегодня генетики подтверждают: действительно, расстройства психики с большей вероятностью могут появиться у ребенка в семье, где родственник страдал от подобного недуга. И причиной этому являются нарушения в строении генов.

Существует такое понятие, как коэффициент наследственного риска. Чем выше этот коэффициент, тем выше вероятность, что ребенок унаследует болезнь родственников.

В прямой зависимости поломок в генах находятся только некоторые психические болезни, например хорея Гентингтона, коэффициент наследственного риска которой составляет 5000. Для сравнения, у такого психического заболевания, как шизофрения, он равен 9.

Расстройства психики чаще вызваны сочетанием наследственной предрасположенности и внешних причин: черепно-мозговых травм, психотравмирующих событий, личных трагедий, внутриутробных повреждений, интоксикаций и пр. Это означает, что даже если родственники страдали психическим расстройством, ребенок не обязательно унаследует их болезнь.

Как влияет степень родства на наследственные болезни?

Риск развития психического заболевания зависит от степени родства с больным членом семьи и от количества больных родственников.

Наибольшая вероятность передачи заболевания у однояйцевых близнецов, далее идет родство 1-й степени (родители, дети, братья, сестры). У родственников 2-й степени родства риск существенно снижается

Так, при шизофрении, имеющейся у матери и отца, вероятность ее возникновения у детей составляет 46%, если болен один родитель – около 13%, больны дедушка или бабушка – 5%.

Какие психические заболевания передаются по наследству чаще всего

1. Нарушения психического развития детей

  • Синдром дефицита внимания с гиперактивностью (СДВГ) проявляется импульсивностью, трудностью с концентрацией внимания, повышенной двигательной активностью. Часто это расстройство совмещается с депрессивными состояниями, нарушениями поведения.
  • Дислексия – неспособность читать, сопоставлять то, что написано, с речью в некоторых случаях имеет наследственный характер.
  • Аутизм – это тяжелое психическое расстройство, выражающееся в нарушении социальной адаптации. Ребенок-аутист замкнут, он не хочет общаться с внешним миром, существует в своем личном пространстве. Он не выносит никаких перемен, у него есть собственные ритуалы, которые он строго соблюдает. Он постоянно повторяет стереотипные движения (раскачивания, подпрыгивания) или одни и те же фразы.

Обычно диагноз «аутизм» ставят в первые три года жизни ребенка.

Считается, что роль наследственности в возникновении этого заболевания велика.

2. Шизофрения

Это психическое заболевание, для которого характерны нарушения в мышлении, восприятии мира, неадекватное поведение и ненормальная реакция на раздражители. Заболевание может сопровождаться возбуждением, бредом, галлюцинациями. Больные подвержены депрессиям и склонны к суициду.

Как правило, начало болезни приходится на возраст от 20–22 до 30 лет.

Наследственность играет существенную роль в возникновении этого заболевания, но не меньшее значение приобретают и другие факторы: осложнения при вынашивании, трудные роды у матери, инфекции, тяжелые психоэмоциональные ситуации и даже рождение зимой.

3. Аффективное биполярное расстройство

Иначе это психическое заболевание называют маниакально-депрессивным психозом. Протекает оно с чередованием фаз: депрессии и возбуждения, иногда с агрессией. Между этими фазами возможны промежутки просветления.

4. Болезнь Альцгеймера

Это заболевание развивается после 65 лет и выражается сначала в забывчивости, трудности с концентрацией внимания. Затем возникают спутанность сознания, потеря ориентации в пространстве. Появляются раздражительность, немотивированная агрессия, нарушается речь. Развивается слабоумие.

Достаточно редко болезнь начинается раньше, и здесь существенную играет роль наследственный фактор – патологический ген.

Другие психические заболевания, передающиеся по наследству:

  • эпилепсия;
  • психопатии;
  • алкогольная зависимость;
  • деменция;
  • синдром Дауна;
  • хорея Гентингтона;
  • синдром «кошачьего крика»;
  • синдром Клайнфельтера.

Все эти психические заболевания могут передаваться по наследству. В то же время они могут появиться в семье, где подобными расстройствами никто не страдал. Правда, риск заболевания в этом случае меньше, но он существует. Так, заболеть шизофренией в совершенно «здоровой» семье можно с вероятностью 1%.

Если есть риск

Многие люди боятся передать детям наследственные болезни (даже если ими страдали дальние родственники), особенно психические расстройства, и поэтому предпочитают отказаться от рождения ребенка. Правилен ли подобный подход?

Наследственное заболевание совершенно не означает, что у ребенка оно обязательно появится. Да, такой риск есть, но он имеется и у детей из «наследственно благополучных» семей. Более того, вероятность передачи наследственной болезни может быть очень низка. Все зависит от того, какое именно генетическое заболевание существует в семейном анамнезе, у кого из родственников наблюдалась патология, насколько тяжелым было отклонение и многих других факторов.

Понять, насколько велик риск, можно после прохождения медико-генетической экспертизы. Поэтому при сомнениях и опасениях «плохой наследственности» самым правильным будет обращение к специалисту-генетику.

Передается ли шизофрения по наследству: мнение эксперта

Шизофрения – широко известное психическое заболевание. В мире этим недугом страдает несколько десятков миллионов человек. Среди основных гипотез возникновения болезни особенно пристальное внимание вызывает вопрос: может ли шизофрения передаваться по наследству?

Наследственность как причина возникновения болезни

Беспокойство, передается ли шизофрения по наследству, вполне оправданно для людей, в чьих семьях зафиксированы случаи недуга. Также возможная дурная наследственность тревожит при вступлении в брак и планировании потомства.

Ведь этот диагноз означает серьезные помрачения психики (само слово «шизофрения» переводится как «расколотое сознание»): бред, галлюцинации, нарушения моторики, проявления аутизма. Больной человек становится неспособным адекватно мыслить, контактировать с окружающими и нуждается в психиатрическом лечении.

Первые исследования семейного распространения недуга проводились еще в 19-20 вв. Например, в клинике немецкого психиатра Эмиля Крепелина, одного из основоположников современной психиатрии, изучались большие группы пациентов-шизофреников. Интересны также работы американского профессора медицины И.Готтесмана, занимавшегося этой темой.

В подтверждении «семейной теории» изначально существовал ряд сложностей. Чтобы с достоверностью определить, генетическое заболевание или нет, необходимо было воссоздать полную картину недугов в роду человека. Но многие пациенты просто не могли с достоверностью подтвердить наличие или отсутствие психических отклонений в своей семье.

Может быть, о помрачениях рассудка и было известно кому-то из родных пациентов, но эти факты зачастую тщательно скрывались. Тяжелое психотическое недомогание в родне накладывало социальное клеймо на всю семью. Поэтому подобные истории замалчивались и для потомков, и для врачей. Зачастую связи между больным человеком и его родственниками совсем разрывались.

И все-таки семейная последовательность в этиологии болезни была прослежена очень четко. Хотя и однозначно утвердительного ответа, что шизофрения передается по наследству обязательно, врачи, к счастью не дают. Но генетическая предрасположенность находится в ряде основных причин возникновения этого психического расстройства.

Статистические данные «генетической теории»

На сегодняшний день психиатрия накопила достаточно информации, чтобы прийти к определенным выводам в вопросе, как передается шизофрения по наследству.

Медицинская статистика утверждает, что если в вашей родовой линии помрачений рассудка нет и не было, то и вероятность заболеть у вас – не более 1%. Однако, если такие заболевания все-таки были у ваших родственников, то и риск соответственно увеличивается и составляет от 2 до почти 50%.

Самые высокие показатели зафиксированы в парах однояйцевых (монозиготных) близнецов. Они имеют совершенно идентичные гены. Если один из них заболел, то у второго риск возникновения патологии составляет 48%.

Большое внимание медицинского сообщества привлек случай, описанный в трудах по психиатрии (монография D. Rosenthal et al.) еще в 70-е годы 20 века. Отец четверки однояйцевых близнецов – девочек страдал психическими отклонениями. Девочки развивались нормально, учились и общались со сверстниками. Одна из них не окончила учебное заведение, но трое завершили обучение в школе благополучно. Однако в возрасте 20 – 23 года шизоидные расстройства рассудка стали развиваться у всех сестер. Самая тяжелая форма – кататоническая (с характерной симптоматикой в виде психомоторных расстройств) была зафиксирована у не окончившей школу девушки. Конечно, в подобных ярких случаях сомнений, это наследственное заболевание или приобретенное, у психиатров просто не возникает.

46% вероятности заболеть у потомка, если в его семье болен один из родителей (или мать, или отец), но вот и бабушка, и дедушка больны оба. Генетическое заболевание в семье в таком случае уже также фактически подтверждено. Аналогичный процент риска будет у человека, у кого и отец, и мать были психически больны при отсутствии аналогичных диагнозов среди их родителей. Здесь также довольно легко проследить, что болезнь пациента – наследственная, а не приобретенная.

Если в паре разнояйцевых близнецов у одного из них обнаружена патология, то риск второго заболеть составит 15-17%. Такая разница между однояйцевыми и разнояйцевыми близнецами связана с одинаковым генетическим набором в первом случае, и разным – во втором.

13% вероятности будет у человека с одним больным в первом-втором коленах семьи. Например, вероятность возникновения недуга передана от матери при здоровом отце. Либо наоборот – от отца, тогда как мать здорова. Вариант: оба родителя здоровы, но один душевнобольной есть среди бабушек и дедушек.

9%, если ваши родные брат или сестра пали жертвой психического недуга, но больше подобных отклонений в ближайших коленах родни не обнаружено.

От 2 до 6% риск составит у того, в чьей семье есть только один случай патологии: один из ваших родителей, сводный брат или сестра, дядя или тетя, кто-либо из племянников и т.д.

Обратите внимание! Даже 50% вероятности — это не приговор, не 100%. Так что не стоит принимать чересчур близко к сердцу народные мифы о неизбежности передачи больных генов «через поколение» или «из поколения в поколение». В настоящий момент генетика все еще не обладает достаточными познаниями, чтобы с точностью утверждать неизбежность возникновения болезни в каждом конкретном случае.

По какой линии более вероятна дурная наследственность?

Вместе с вопросом, передается по наследству или нет страшный недуг, пристально был изучен сам тип наследования. По какой линии передается заболевание наиболее часто? В народе бытует мнение, что наследственность по женской линии встречается куда реже, чем по мужской.

Однако психиатрия такую догадку не подтверждает. В вопросе, как наследуется шизофрения чаще – по женской линии или по мужской, врачебная практика выявила, что пол не имеет решающего значения. То есть передача патологического гена от матери к сыну или дочери возможна с той же вероятностью, что и от отца.

Миф о том, что болезнь передается детям чаще именно по мужской линии связан лишь с особенностями протекания патологии у мужчин. Как правило, душевнобольные мужчины просто больше заметны в социуме, чем женщины: они более агрессивны, среди них больше алкоголиков и наркоманов, тяжелее переживают стрессы и психические осложнения, хуже адаптируются в обществе после перенесенных душевных кризисов.

О других гипотезах возникновения патологии

Бывает ли, что расстройство психики поражает человека, в чьем роду абсолютно точно не было подобных патологий? Медицина однозначно утвердительно ответила на вопрос, может ли шизофрения быть приобретенной.

Наряду с наследственностью среди основных причин развития недуга врачи также называют:

  • нейрохимические нарушения;
  • алкоголизм и наркоманию;
  • травмирующий психику опыт, пережитый человеком;
  • болезни матери в период вынашивания плода и т.д.

Схема развития психического расстройства всегда индивидуальна. Наследственное заболевание или нет — в каждом конкретном случае видно лишь при учете всех возможных причин расстройства сознания.

Очевидно, что при сочетании дурной наследственности и иных провоцирующих факторов риск заболеть будет выше.

Как быть, если вы в группе риска?

Если вы точно знаете о существовании у себя врожденной предрасположенности к нарушениям психики, необходимо серьезно отнестись к этой информации. Любую болезнь проще предупредить, чем вылечить.

Простые профилактические меры вполне по силам любому человеку:

  1. Ведите здоровый образ жизни, откажитесь от алкоголя и других вредных привычек, подберите оптимальный для себя режим физической активности и отдыха, контролируйте питание.
  2. Регулярно наблюдайтесь у психолога, своевременно обращайтесь к врачу при любых неблагоприятных симптомах, не занимайтесь самолечением.
  3. Уделяйте особое внимание своему психическому самочувствию: избегайте стрессовых ситуаций, чрезмерных нагрузок.

Помните, что грамотное и спокойное отношение к проблеме облегчает путь к успеху в любом деле. При своевременном обращении к врачам, в наше время успешно лечатся многие случаи шизофрении, а пациенты получают шанс на здоровую и счастливую жизнь.

Шизофрения передается по наследству от матери или отца?

Автор вопроса: Тиммоти Муразик
Оценка: 4,5/5 (13 голосов)

У вас больше шансов заболеть шизофренией, если она есть у кого-то в вашей семье. Если это родитель , брат или сестра, ваши шансы возрастут на 10%. Если оба ваших родителя имеют его, у вас есть 40% шанс получить его.

Может ли шизофрения передаваться по наследству от родителей?

Исследования показали, что наследственность или генетика могут быть важным фактором, способствующим развитию шизофрении.Хотя точная причина этого сложного расстройства неизвестна , люди, у которых есть родственники с шизофренией, как правило, имеют более высокий риск ее развития.

Шизофрения пропускает поколение?

Как и большинство других психических расстройств, шизофрения не передается напрямую от одного поколения к другому генетически , и у этого заболевания нет единой конкретной причины.

Как проявляется шизофрения в семье?

Генетика.Шизофрения, как правило, передается по наследству, но считается, что за нее не отвечает ни один ген . Более вероятно, что различные комбинации генов делают людей более уязвимыми к этому заболеванию. Однако наличие этих генов не обязательно означает, что у вас разовьется шизофрения.

Причиной шизофрении являются родители?

Шизофрения не имеет одной причины . Играет роль комбинация генов от обоих родителей. Так же как и неизвестные факторы окружающей среды.Эксперты считают, что ребенок должен унаследовать химический дисбаланс в мозге, чтобы он развился.

Найдено 19 связанных вопросов

В каком возрасте обычно диагностируют шизофрению?

Хотя шизофрения может возникнуть в любом возрасте, средний возраст начала, как правило, составляет от поздних подростков до 20 лет у мужчин и от 20 до 30 лет у женщин. Диагноз шизофрении редко диагностируется у лиц моложе 12 или старше 40 лет.С шизофренией можно жить хорошо.

Как узнать, болен ли мой сын шизофренией?

Каковы симптомы шизофрении у ребенка?

  • Проблемы с отличением снов от реальности (искаженное представление о реальности)
  • Запутанное мышление, такое как путаница телевидения с реальностью.
  • Подробные и причудливые мысли и идеи.
  • Страх или вера в то, что кто-то или что-то причинит ему или ей вред.

Каковы 5 причин шизофрении?

Это также может помочь вам понять, что — если вообще что-нибудь — можно сделать, чтобы предотвратить это пожизненное расстройство.

  • Генетика. Одним из наиболее значимых факторов риска шизофрении могут быть гены. …
  • Структурные изменения головного мозга. …
  • Химические изменения в головном мозге. …
  • Осложнения беременности или родов….
  • Детская травма. …
  • Предыдущее употребление наркотиков.

Какие бывают 4 типа шизофрении?

На самом деле существует несколько различных типов шизофрении в зависимости от симптомов человека, но, как правило, основные типы шизофрении включают параноидную шизофрению, кататоническую шизофрению, дезорганизованную или гебефреническую шизофрению, резидуальную шизофрению и недифференцированную шизофрению.

Вы родились с шизофренией или она развивается?

Считается, что шизофрения является результатом кульминации биологических факторов и факторов окружающей среды. Хотя нет известной причины шизофрении , существуют генетические, психологические и социальные факторы, которые, как полагают, играют роль в развитии этого хронического расстройства.

Кто является носителем гена шизофрении?

Характер наследования шизофрении обычно неизвестен .Риск развития шизофрении несколько выше для членов семей больных по сравнению с населением в целом; однако у большинства людей, у которых есть близкий родственник, страдающий шизофренией, у самих это расстройство не разовьется.

Как узнать, что человек шизофреник?

Симптомы могут включать:

  1. Заблуждения. Это ложные убеждения, не основанные на реальности….
  2. Галлюцинации. Обычно они включают в себя видение или слышание вещей, которых не существует. …
  3. Дезорганизованное мышление (речь). …
  4. Чрезвычайно неорганизованное или ненормальное двигательное поведение. …
  5. Негативные симптомы.

Кто подвержен высокому риску шизофрении?

Установлено, что риск шизофрении несколько выше у мужчин, чем у женщин , при коэффициенте риска заболеваемости, равном 1.3–1,4. Шизофрения имеет тенденцию развиваться позже у женщин, но, по-видимому, нет никаких различий между мужчинами и женщинами в самых ранних симптомах и признаках в продромальной фазе.

Можно ли сдать анализ на ген шизофрении?

Хотя существует эмпирический риск развития шизофрении у родственников, клинический генетический тест в настоящее время не доступен . Генетическое консультирование является вариантом для больных шизофренией и лиц с семейным анамнезом шизофрении.

Каковы положительные признаки шизофрении?

Положительные симптомы шизофрении: вещи, которые могут начать происходить

  • Галлюцинации. Люди, страдающие шизофренией, могут слышать, видеть, обонять или чувствовать то, чего никто другой не делает. …
  • Заблуждения. …
  • Спутанные мысли и неорганизованная речь. …
  • Проблемы с концентрацией внимания. …
  • Двигательные расстройства.

Шизофрения чаще встречается у мужчин или женщин?

Результаты: Заболеваемость шизофренией была в два-три раза выше среди мужчин, чем среди женщин . Несмотря на то, что использование различных диагностических систем дало немного разные уровни риска, повышенный риск для мужчин оставался постоянным.

Кто из известных людей страдает шизофренией?

20 известных людей с шизофренией

  • Лайонел Олдридж — 1941-1998 гг.Профессиональный футболист. …
  • Сид Барретт — 1946 — 2006. Музыкант и основатель Pink Floyd. …
  • Чарльз «Бадди» Болден — 1877–1931 гг. …
  • Эдуард Эйнштейн – 1910-1965. …
  • Зельда Фицджеральд – 1900-1948 гг. …
  • Питер Грин – 1946 – …
  • Даррелл Хаммонд – 1955 – …
  • Том Харрелл – 1946 –

Может ли шизофреник влюбиться?

Психотические симптомы, трудности с выражением эмоций и установлением социальных контактов, склонность к изоляции и другие проблемы мешают встречам с друзьями и установлению отношений.Однако найти любовь, живя с шизофренией , далеко не невозможно .

Что может привести к шизофрении?

Что вызывает шизофрению?

  • Генетические факторы. Предрасположенность к шизофрении может передаваться по наследству. …
  • Биохимические факторы. Считается, что в развитии шизофрении участвуют определенные биохимические вещества в мозге, особенно нейротрансмиттер под названием дофамин….
  • Семейные отношения. …
  • Стресс. …
  • Употребление алкоголя и других наркотиков.

Что слышат шизофреники?

Больные шизофренией могут слышать различные звуки и голоса , которые со временем становятся громче, злобнее и убедительнее. Несколько примеров типовых звуков, которые можно услышать: Повторяющиеся визжащие звуки, напоминающие звуки крыс.Уж больно громкие, бухающие музыкальные темы.

Какие бывают 5 типов шизофрении?

Пять различных типов шизофрении

  • Параноидальная шизофрения.
  • Шизоаффективное расстройство.
  • Кататоническая шизофрения.
  • Дезорганизованная шизофрения.
  • Резидуальная шизофрения.
  • Артикул:

Каковы три стадии шизофрении?

Шизофрения состоит из трех стадий: продромальной, активной и резидуальной .

Что такое плохое воспитание?

Плохое воспитание детей чаще всего связано с ожиданиями плохих результатов , когда дети считаются подверженными риску пренебрежения или жестокого обращения. Вмешательство государства направлено на обеспечение того, чтобы дети были спасены от таких родителей либо путем обучения, либо путем помещения детей в условия, обеспечивающие более надлежащий уход.

Что делать, если у моего ребенка диагностирована шизофрения?

Психотерапия может включать:

  1. Индивидуальная терапия.Психотерапия, такая как когнитивно-поведенческая терапия, с квалифицированным специалистом в области психического здоровья может помочь уменьшить симптомы и помочь вашему ребенку научиться справляться со стрессом и повседневными жизненными проблемами шизофрении. …
  2. Семейная терапия.

Как начинается шизофрения?

Ваш мозг сильно меняется и развивается в период полового созревания . Эти сдвиги могут спровоцировать заболевание у людей, которые находятся в группе риска.Некоторые ученые считают, что это связано с развитием области мозга, называемой лобной корой.

Нарушение нейронального гена PAS3 в семье, страдающей шизофренией

Шизофрения представляет собой сложное заболевание, проявляющееся симптомами, включающими изменения восприятия (галлюцинации), логические рассуждения (бред), мотивации (аволиция), мышления и речи (алогия) . Эти клинические признаки также усугубляются спектром негативных симптомов, которые включают снижение социального взаимодействия, когнитивные нарушения и нарушения внимания.Диагностические критерии этого заболевания установлены Международной классификацией болезней 10-го издания, 1 и Диагностическим и статистическим руководством по психическим расстройствам, 4-е издание. 2 Было предложено множество подтипов шизофрении. У больных шизофрениформным психозом проявляются психотические симптомы, но без ухудшения течения. Распространенность шизофрении в популяции оценивается в 1-2%, при этом возраст начала заболевания у мужчин обычно составляет от позднего подросткового до 20-летнего возраста, а у женщин — с пятилетним отставанием. 3 Поздняя шизофрения возникает после 40 лет в 10% диагностированных случаев и чаще встречается у женщин. Шизофрения также диагностируется в раннем детстве. В целом у пациентов проявляются общие клинические и нейрофизиологические признаки в разном возрасте начала заболевания.

На генетическую основу шизофрении указывает наблюдение более высокого риска среди членов семей пациентов, чем среди населения в целом. 4 Данные исследований усыновления и близнецов также показали более высокий риск среди родственников пострадавших семей, чем среди населения в целом. 4 Из-за сложной природы этого заболевания невозможно установить конкретный тип наследования. Однако математическое моделирование предпочло полигенные модели наследования с участием нескольких генов восприимчивости, действующих аддитивно и, возможно, в сочетании с факторами окружающей среды, что приводит к шизофрении. Доказательства генетической гетерогенности подтверждаются несколькими полногеномными скринингами причинных локусов, анализом сцепления и ассоциативными исследованиями. 5– 7 Эти исследования показали, что некоторые хромосомы, включая 1q, 4q, 5p, 6p, 6q, 8p, 9q, 10p, 13q, 14q, 15q, 22q и Xp, содержат основные гены или гены предрасположенности к шизофрении. 5– 7 Многие из этих мест не были подтверждены независимыми исследованиями. Мы сообщаем здесь о семье с шизофренией и транслокационной (9; 14) хромосомой с точкой разрыва в новом транскрипционном факторе bHLH-PAS на хромосоме 14.

МАТЕРИАЛЫ И МЕТОДЫ

Субъектов

Диагнозы были установлены опытным психиатром (WJM) с использованием структурированной оценки SADS-L, PAS-ADD и анализа больничных историй болезни.Пробанд (клеточная линия L6874) имеет тяжелую неспособность к обучению и клинический диагноз шизофреноформного психоза, установленный в ее позднем подростковом возрасте, в соответствии с критериями DSM-IV. У нее отмечаются периоды почти непрерывных вспышек возбуждения, эмоциональной лабильности и стереотипных позирующих движений. Зрительные и слуховые галлюцинации отмечаются в результате явной озабоченности раздражителями, которые не могут быть обнаружены в ее окружении, проявляются в виде периодов пристального взгляда на предметы или стены, во время которых она не может отвлечься, и повторяющихся криков и криков без внутренних или явных внешних причин.Явления купировались комбинацией нейролептиков (депо-пипортил и хлорпромазин). Неоднократные попытки уменьшить дозу лекарств привели к возобновлению симптомов. Хотя расстройство не имеет циклического характера и эпизодов депрессивного расстройства, которое легче диагностировать у лиц с тяжелой умственной отсталостью, нельзя полностью исключить возможность основного коморбидного аффективного расстройства, унаследованного от отца. Ее мать (номер клеточной линии SMOM) физически нормальна с легкими или пограничными интеллектуальными нарушениями.Она посещала специальную школу для детей с задержкой развития. История шизофренического заболевания началась у нее в конце тридцати и включала симптомы формального расстройства мышления, идеи самореференции, причудливые бредовые идеи и соматические галлюцинации. Это сопровождалось тяжелой социальной дисфункцией, потребовавшей госпитализации в психиатрический стационар. Признаков аффективного расстройства не было. Она соответствовала критериям DSM-IV по симптомам и продолжительности шизофрении, которая реагировала на стандартные пероральные нейролептики (фенотиазин).У умершего отца было диагностировано биполярное расстройство I типа по DSM-IV, которое началось в возрасте двадцати лет. Расстройство происходило по классической схеме с повторяющимися эпизодами мании, чередующимися с большим депрессивным расстройством, которое требовало госпитализации. Не удалось получить изображения черепа у этих субъектов. И пробанд, и мать имели кариотип 46,ХХ,t(9;14)(q34;q13). Отец имел нормальный кариотип. Ранее сообщалось о цитогенетических данных об этом семействе. 8 Известно, что транслокация была у старшего брата пробанда с серьезной задержкой умственного развития.Однако этот сибс был разлучен с семьей в раннем возрасте, и нет доступных клеточных линий или информации о психическом статусе.

Картирование хромосом, отсортированных потоком

Трансформированные клеточные линии лимфобластов подвергали потоковой сортировке на аберрантные хромосомы, как описано ранее. 9 В общей сложности 300–500 копий нормальной или аберрантной отсортированной хромосомы 14 были подвергнуты амплификации DOP-PCR перед использованием в качестве матрицы для картирования, как описано ранее. 9 Панель из 16 проксимальных маркеров хромосомы 14q и 16 специфических маркеров хромосомы 9q34, выбранных из физической карты Института геномных исследований Уайтхеда STS YAC (www-genome.wi.mit.edu), использовали для картирования в стандартной 20 мкл ПЦР. реакции, которые включали 40 нг геномной ДНК человека или аберрантные хромосомы, отсортированные потоком. Маркер D14S49 картирован во втором интроне гена NPAS3 . Маркер D14S1014 картирован в пределах третьего интрона KIAA0391 гена . Праймеры, условия и циклы ПЦР для этих маркеров представлены Research Genetics.Пары праймеров, перечисленные в таблице 1, были сконструированы из последовательностей клонов ВАС R1075M22 (инвентарный номер Genbank AL157689), R1078I14 (инвентарный номер Genbank AL161851) и R66M11 (инвентарный номер Genbank AL133305) с использованием премьеры праймеров 3 (www-genome. wi.mit.edu/cgi-bin/primer/primer3.cgi), для точного картирования точки разрыва хромосомы 14q в пределах NPAS3 . Геномную последовательность клона ВАС R173D09 (инвентарный номер Genbank AL121594) использовали для конструирования пар праймеров для картирования в пределах гена KIAA0391 (инвентарный номер Genbank NM_014672).

Таблица 1

Праймеры, условия ПЦР и циклы, используемые для картирования генов NPAS3 и KIAA0391

Быстрая амплификация концов кДНК (RACE)

5′- и 3′-RACE были выполнены на готовой к Marathon библиотеке кДНК головного мозга плода человека (21–30 недель беременности, 10 объединенных белых мужчин и женщин) (ClonTech), как указано производителем. Праймеры для 5′ (F-5′ tgccttgtcgagctggctggtaa 3′, F-5′ gctggctggtaatggctgcagag 3′) и 3′ (F-5’acggagccagctcagcatcttcc 3′) реакций RACE были сконструированы из частичных последовательностей кДНК, принадлежащих NPAS3 , с температурами плавления от 65°C до 72°C с использованием Primer Premiere 3.Стандартные реакции ПЦР объемом 50 мкл проводили с использованием смеси полимераз Advantage Taq (ClonTech), как указано производителем. Продукты RACE клонировали с помощью набора pCR4-TOPO TA (Invitrogen) и секвенировали с помощью меченных IRD700/800 M13 праймеров с использованием набора для секвенирования цикла циклических праймеров с флуоресцентной маркировкой Thermo Sequenase с 7-деаза-dGTP (Amersham Biosciences). Реакции проводили на ДНК-секвенаторе Licor Long Reader 4200.

Скрининг библиотеки кДНК

Библиотека кДНК λ TriplEx Human Fetal Brain 5’ Stretch Plus (20–25 недель беременности, 10 объединенных белых самцов и самок) (ClonTech) подвергалась скринингу, как указано производителем.Зонд ПЦР, сконструированный с помощью Primer Premiere 3 с использованием частичных последовательностей кДНК, полученных в результате поиска в базе данных, и RACE, использовали для скрининга библиотеки кДНК. Пару праймеров (F-5′ tcttggggagcagaaggtaa 3′, R-5′ agattctgccctcagcaatg 3′) использовали в стандартных 20 мкл реакциях ПЦР, содержащих 1,5 ммоль/л MgCl 2 , и с денатурацией цикла ПЦР в течение трех минут с последующим 30 циклов: 94°С в течение 30 секунд, 58°С в течение 30 секунд, 72°С в течение 30 секунд и окончательное удлинение при 72°С в течение пяти минут.Сто нг продукта ПЦР метили 32 P-α-dCTP (10 Ки/мл) с использованием набора REDIPrime (Amersham Biosciences). Всего было проверено около 1,9 × 10 6 бляшкообразующих единиц. Гибридизацию проводили с раствором ExpressHyb (ClonTech), как указано производителем. Из каждого планшета отбирали до 35 положительных бляшкообразующих единиц и превращали в плазмиды, как указано производителем. Плазмиды секвенировали с помощью праймеров, меченных IRD700/800 M13, с использованием набора для циклического секвенирования праймеров, меченных флуоресцентной маркировкой Thermo Sequenase, с 7-деаза-dGTP (Amersham Biosciences).Реакции проводили на ридере Licor DNA Sequencer Long 4200.

Определение структуры генома

Консенсусные последовательности

были собраны из частичных последовательностей кДНК, полученных в результате RACE, скрининга библиотеки кДНК и поиска в базе данных с использованием программного обеспечения GeneTool версии 1.0. Составная геномная последовательность интервала между маркерами D14S70 и D14S730 была создана путем сопоставления каркасов данных геномной последовательности из Celera (Celera.com) и Genbank (www.ncbi.nlm.nih.gov), используя BLAST2 (www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html). Геномную структуру определяли путем сопоставления собранных последовательностей кДНК с составной геномной последовательностью с помощью BLAST2.

Нозерн-блоттинг

В качестве зондов использовали последовательность кДНК размером 2,6 т.п.н., охватывающую экзоны с 7 по 12, и кДНК размером 1,6 т.п.н. экзона 2 NPAS3 . Полноразмерную кДНК гена GAPDH использовали в качестве контрольного зонда. Зонды метили 5 мкл 32 P-α-dCTP (10 мКи/мл) с использованием набора для мечения REDIPrime (Amersham Biosciences).Нозерн-блоты мультитканей человека, 12 мультитканей, Блот IV и Блот II (ClonTech), гибридизовали с раствором ExpressHyb (ClonTech), как указано производителем.

Исследования клеточной локализации белков

Открытую рамку считывания большой изоформы белка NPAS3 клонировали с помощью стандартной ПЦР с использованием библиотеки кДНК λ TriplEx Human Fetal Brain 5′ Stretch Plus (объединенные 10 самцов/самок, срок беременности от 20 до 25 недель) (ClonTech) и готовых к марафону человеческих библиотека кДНК головного мозга плода (21–30 недель беременности, 10 объединенных белых мужчин и женщин) (ClonTech) в качестве шаблонов.Стандартные реакции ПЦР проводили с полимеразой Platinum Pfx Taq (Invitrogen) в соответствии с указаниями производителя. Пары праймеров (F-5′ aggcatccatcattcgactt 3′, R-5′ cgtggtgtagaccctctgc 3′) использовали с денатурацией цикла ПЦР при 94°С в течение трех минут, 35 циклов 94°С в течение 30 секунд, 60°С в течение 30 секунд. секунд и 68°C в течение 150 секунд, а затем 72°C в течение пяти минут. Клонированную открытую рамку считывания секвенировали с помощью IRD700/800 M13-меченых праймеров с использованием набора для секвенирования цикла праймеров с флуоресцентной маркировкой Thermo Sequenase с 7-деаза-dGTP (Amersham Biosciences), затем подвергали сайт-направленному мутагенезу для введения сайтов рестрикции для клонирования в Вектор EGFP-N1 (ClonTech).Стандартные реакции ПЦР, содержащие примерно 100 нг плазмидной ДНК и полимеразы Platinum Pfx Taq , устанавливали в соответствии с указаниями производителя. Цикл ПЦР представлял собой денатурацию при 94°С в течение трех минут, 30 циклов при 94°С в течение 30 секунд, 57°С в течение 30 секунд, 72°С в течение 90 секунд, а затем 72°С в течение пяти минут. Пары праймеров (F-5′ agatct atgaaccacatttgcagtccctggatg 3′, R-5′ ggatcc gaggaccgagtcgggaatggc 3′) вводили сайты Bgl II и Bam HI для клонирования в вектор EGCFP-N HI.Плазмиды секвенировали с помощью набора для секвенирования терминатора IRDye 800 (Amersham Biosciences) с использованием прямого и обратного праймеров EGFP-N1 в дополнение к внутренним праймерам внутри кДНК. Цикл секвенирования представлял собой 94°С в течение пяти минут денатурации, 94°С в течение 30 секунд, 57°С в течение 30 секунд и 72°С в течение 60 секунд, 45 циклов. Реакции проводили на ДНК-секвенаторе Licor Long Reader 4200.

Около 1 × 10 4 -1 × 10 5 клеток/мл COS1 и линии клеток трансформированных фибробластов кожи взрослого человека выращивали на покровных стеклах размером 22 × 22 мм при 37°C в среде DMEM/10% эмбриональной бычьей сыворотки (Invitrogen ) за один-два дня до трансфекции реагентом Fugene 6 (Invitrogen), как указано производителем; 3 мкл реагента Fugene 6 использовали с 1 мкг плазмидной конструкции EGFP.Временную трансфекцию проводили в течение 24-48 часов при 37°С. Покровные стекла с трансфицированными клетками промывали в PBS (комнатная температура) перед добавлением 15 мкл монтажной среды, содержащей DAPI (Vector Laboratories Incorporation). Покровные стекла помещали на предметные стекла Fisherbrand Superfrost/Plus (Fisher Scientific) и исследовали с помощью фильтров DAPI и FITC составного микроскопа Olympus BX50 (с флуоресценцией URA). Изображения были получены с помощью ImageGear 6.6.4 и программного обеспечения Spot версии 2.2.

РЕЗУЛЬТАТЫ

Картирование точек разрыва транслокаций на хромосомах 9q34 и 14q13

Чтобы охарактеризовать соединения точек разрыва транслокации в этом семействе, панель из 14 маркеров проксимальной хромосомы 14q и 16 маркеров хромосомы 9q34 была выбрана из физических карт STS YAC Института геномных исследований Уайтхеда для определения соединений точек разрыва на аберрантных хромосомах, отсортированных потоком ( рисунок 1). И у пробанда, и у матери была точка разрыва, определенная на хромосоме 14 в интервале примерно 683 т.п.н. между маркерами D14S730 и D14S70.На хромосоме 9q34 точка пересечения транслокации была определена между маркерами D9S752 и D9S972 у обоих субъектов с интервалом примерно 100 т.п.о. (рис. 1). Делеций или сложных перестроек 9-й хромосомы не обнаружено, а нарушений генов в этом интервале не выявлено. Гены отображения ближе, в пределах 1 Мб точки останова перекрестка на 9q34, три гены неизвестной функции ( KIAA0169 (XM_052725, KIAA1848 (AB058751), LOC204994 (XM_114811)), пять гипотетических генов ( LOC255259 (XM_173231), LOC169627 (XM_095823), LOC206943 (XM_121923), LOC169656 (XM_095844), LOC138519 (XM_070946)), и четыре известных генов ( LSFR2 (XM_026945), CRAT (NM_000755 ), PPP2R4 (NM_021131), AD-003 (NM_014064) (ансамбль (www.ensembl.org), средство просмотра карт NCBI (www.ncbi.nih.gov/cgi-bin/Entrez/hum_srch)).

Рисунок 1

Анализ точек разрыва хромосом 9 и 14 пробанда и матери с использованием анализа хромосом с сортировкой потоком. (А) анализ хромосомы 14q13. Положение гена NPAS3 показано между D14S730 и D14S70. Положение гена KIAA0391 показано между D14S988 и D14S888. (B) Анализ хромосомы 9q34. Расстояния на карте маркеров нарисованы не в масштабе.Знак плюс указывает на наличие маркеров либо на производной 9, либо на 14 хромосоме. Пунктирной линией обозначено место соединения точки разрыва транслокации.

Выделение и характеристика

гена NPAS3

Чтобы идентифицировать гены в пределах интервала точки останова транслокации 683 т.п.н. на хромосоме 14q13, геномная последовательность была аннотирована для кластеров EST. Эти неполные последовательности кДНК использовали для конструирования зондов для скрининга библиотеки кДНК головного мозга эмбриона человека 5′-растяжения λTriplEX и выполнения 5′- и 3′-RACE в библиотеке кДНК мозга плода человека Marathon Ready.В этом интервале были выделены две кДНК размером 2,5 и 3,4 т.п.н. (инвентарные номера GenBank AY157302, AY157303). Эти кДНК были очень похожи на ген мышиного нейрона PAS3 ( Npas3 ) (инвентарный номер Genbank AF173871) на мышиной хромосоме 12 в области консервативной синтении с генами на человеческой хромосоме 14. Мы не смогли выйти за пределы 5′ эти две альтернативные кДНК с использованием RACE в библиотеке кДНК мозга эмбриона человека Marathon Ready; однако нельзя исключать возможность того, что это частичные кДНК.Нейронный ген PAS3 человека ( NPAS3 ), по оценкам, имеет размер около 863 т.п.н. с 12 экзонами, которые кодируют два альтернативных транскрипта (таблица 2). Два псевдогена (инвентарные номера Genbank AK002000, AK000865) неизвестной идентичности и размером 2,2 т.п.н. и 2 т.п.н. картируются во втором и пятом интронах этого гена соответственно. Эти псевдогены имеют короткие открытые рамки считывания и содержат 3′-поли-А-хвост. Белок из 901 аминокислоты, кодируемый кДНК размером 3,4 т.п.н., имеет домен димеризации bHLH (базовая спираль-петля-спираль) на амино-конце (аминокислоты с 31 по 72), PAS ( P eriod, A рецептор рилуглеводорода, S (аминокислоты с 117 по 183), мотив PAC (PAS-связанный карбоксильный конец) (аминокислоты с 361 по 404) и двудольный сигнал ядерной локализации на карбоксильном конце (аминокислоты с 568 по 585).Этот белок примерно на 90% идентичен белку NPAS3 мыши. Меньшая кДНК размером 2,5 т.п.н. кодирует укороченный белок из 153 аминокислот, который содержит домен PAS (аминокислоты с 45 по 113). Нозерн-анализ с зондом размером 2,6 т.п.н., содержащим экзоны с 7 по 12, показал экспрессию транскрипта размером приблизительно 7,5 т.п.н. только в нескольких тканях мозга взрослого человека, включая мозжечок, кору головного мозга, продолговатый мозг, затылочную долю, лобную долю, височную долю, скорлупу, миндалевидное тело, хвостатое тело. ядро, мозолистое тело, гиппокамп, черное вещество и таламус (рис. 2).Зонд экзона 2, специфичный к меньшей альтернативной кДНК размером 2,5 т.п.н., не проявлял экспрессии в тканях взрослого человека. Однако было обнаружено, что кДНК размером 2,5 и 3,4 т.п.н. экспрессируются в головном мозге плода человека (20–30 недель беременности). Исследования клеточной локализации с изоформой белка NPAS3, состоящей из 901 аминокислоты, помеченной на карбоксильном конце усиленным зеленым флуоресцентным белком, показали, что этот белок был локализован в ядре COS1 и трансформировал клеточные линии фибробластов кожи взрослого человека (рис. 3).

Таблица 2

Геномная структура NPAS3

Рисунок 2

Нозерн-анализ гена NPAS3 , показывающий один приблизительно 7.Транскрипт размером 5 т.п.н., повсеместно экспрессирующийся в мозге взрослого человека. кДНК размером 2,6 т.п.н., охватывающая экзоны с 7 по 12 изоформы большого транскрипта, использовали в качестве зонда для гибридизации на нозерн-блоттинге взрослых мультитканей ClonTech (12 мультитканей взрослых; блот II мозга взрослых и блот IV мозга взрослых). Полноразмерную кДНК гена GAPDH использовали в качестве контрольного зонда.

Рисунок 3

Клеточная локализация большой изоформы белка NPAS3.Временные трансфекции конструкцией NPAS3-EGFP-N1 проводили в (A) COS1 и (B) трансформированных клеточных линиях фибробластов кожи взрослого человека. Для визуализации сигналов использовались фильтры DAPI и FITC. Изображения, полученные от каждого фильтра, были объединены с помощью программного обеспечения Spot версии 2.2. Синие сигналы представляют ядро, окрашенное DAPI; зеленые сигналы представляют белок с меткой EGFP.

Картирование с высоким разрешением в пределах

гена NPAS3 Картирование

было выполнено с дополнительными 16 амплимерами в пределах гена NPAS3 , чтобы более точно определить точку разрыва соединения на хромосоме 14q13.Физическое картирование с использованием этих маркеров показало, что место соединения точки разрыва транслокации как у пробанда, так и у матери находилось между 66M11SR и SDK1 , примерно 7,9 т.п.о. в пределах третьего интрона (рис. 4). Соединение точки разрыва транслокации затронуло оба альтернативных транскрипта, что привело к смещению первых 124 аминокислот амино-конца более крупной изоформы из 901 аминокислоты и первых 52 аминокислот амино-конца предполагаемой меньшей изоформы из 153 аминокислот.Домен bHLH на амино-конце более крупного белка был разрушен, что предотвратило связывание белка с ДНК. Для обеих изоформ белка домены PAS, необходимые для димеризации, были разрушены. Мотив PAC и двудольный сигнал ядерной локализации внутри карбоксильного конца более крупной изоформы белка оставались интактными. Интересно, что у пробанда были обнаружены делеции трех маркеров (I3DK, D14S49, I4DK), которые картировались во втором интроне NPAS3 , что предполагает максимальную микроделецию в этом интроне размером 94 т.п.н. (рис. 4).Анализ этой удаленной геномной последовательности показал несколько возможных сайтов связывания факторов транскрипции. Ни одна из этих дополнительных микроперестроек не была обнаружена у матери.

Рисунок 4

Идентификация реаранжировки в гене NPAS3 . (A) Схема гена NPAS3 , показывающая положения маркеров, используемых при картировании. Пунктирная линия указывает точку останова транслокации. Функциональными доменами или мотивами изоформ белка NPAS3 являются bHLH (основная спираль, петлевая спираль), PAS (период, рецептор арильных углеводородов, односторонний), PAC (PAS-ассоциированный карбокси-конец), NLS (двудольный сигнал ядерной локализации).Маркеры, помещенные в рамку, — это те, которые были удалены в пробанде. (B) Сортированный анализ хромосом матери с выбранными маркерами в гене NPAS3 . (C) Сортированный анализ хромосом пробанда с выбранными маркерами в гене NPAS3 . Картирование проводили на трех отдельных хромосомах der(14) или der(9), отсортированных потоком, или на пуле из трех хромосом der(14) или der(9).

Область хромосомы 14q13 за пределами NPAS3 также подвергалась скринингу на наличие дополнительных реаранжировок у матери и пробанда.У пробанда была обнаружена микроделеция с предполагаемым максимальным размером 22 т.п.н. в третьем интроне гена KIAA0391 (инвентарный номер Genbank NM_014672). В частности, были удалены маркеры D14S1014 и K2DK. Эта перестройка отсутствовала у матери. KIAA0391 имеет неизвестную функцию, неизвестную идентификацию и карты примерно на 1 Мб дистальнее NPAS3 . Кроме того, удаленный интервал содержит несколько возможных сайтов связывания факторов транскрипции.

ОБСУЖДЕНИЕ

У пробанда и матери имеется точка разрыва транслокации в третьем интроне гена NPAS3 , которая нарушает кодирующий потенциал обоих альтернативных транскриптов. Исследования с FISH подтвердили разрыв в этом гене. 10 Ген NPAS3 принадлежит BHLH-PAS ( B ASIC H ELIX L OOP H ELIX, P EROIOD, A 902-rEply Gydeplator , , REPLER, , , REPLER. надсемейство факторов транскрипции, которые участвуют в широком спектре функций, включая циркадные колебания ( Npas2, Per, Clock ), нейрогенез ( Sim ), метаболизм токсинов ( Arnt ), гипоксию ( Hifia ) и развитие трахеи ( Trh ). 11– 14 Была идентифицирована малая изоформа белка, которая может кодироваться малой изоформой транскрипта NPAS3 . Эта небольшая изоформа белка может образовывать гетеродимеры через свой домен PAS с более крупной изоформой белка NPAS3 или другими белками, содержащими домен PAS, для регуляции активности. Этот способ регуляции наблюдается с изоформой белка PITX2D 15 и другими транскрипционными факторами bHLH-PAS. 11– 14 Белок NPAS3 содержит домен bHLH, который, как известно, связывается с ДНК, и в этом исследовании было обнаружено, что он локализован в ядре, что позволяет предположить, что он может быть фактором транскрипции.Экспрессия обеих изоформ транскриптов была также обнаружена в развивающемся головном мозге плода человека (20-30 недель беременности). Мышиный ген Npas3 экстенсивно экспрессируется в развивающейся центральной нервной системе, 16 , но его роль еще предстоит определить. Экспрессия мышиного гена Npas3 специфически в развивающейся нервной системе во время раннего эмбриогенеза позволяет предположить, что гаплонедостаточность может приводить к аномалиям центральной нервной системы, вызывающим умственные нарушения.До сих пор было высказано предположение, что только ген SIM2 семейства факторов транскрипции bHLH-PAS, картированный на хромосоме 21 человека, связан с поведенческими проблемами, наблюдаемыми у пациентов с синдромом Дауна. 17 Никакие другие члены этого семейства факторов транскрипции еще не были связаны с шизофренией, что позволяет предположить, что NPAS3 является первым геном этого суперсемейства, связанным с этим заболеванием. Тот факт, что этот ген был экспрессирован в 13 тканях мозга взрослых, включая гиппокамп, таламус и кору, подтверждает возможную роль в развитии и/или функционировании этих структур, которые могут играть роль при шизофрении. 18

Домен PAS обеих изоформ белка, необходимый для димеризации, нарушен как у пробанда, так и у матери. Ожидается, что такое нарушение разрушит функцию малой изоформы белка NPAS3. В случае большой изоформы белка соединение в точке разрыва транслокации оставляет домен bHLH нетронутым на амино-конце, а PAC и мотивы двудольной ядерной локализации нетронутыми на карбоксильном конце. При таком нарушении гена NPAS3 изоформа большого белка NPAS3, вероятно, будет нефункциональной, что совместимо с вкладом гаплонедостаточности в шизофрению у матери и пробанда.Интересно, что у пробанда было обнаружено соединение точки разрыва транслокации в сочетании с микроделецией 94 т.п.н. в пределах NPAS3 и микроделецией 22 т.п.н. в пределах KIAA0391 . Это открытие не является неожиданным, так как хромосомы семейной транслокации приобретают дополнительные перестройки за счет неравной рекомбинации во время мейоза. Нельзя исключить возможность незначительных перестроек в других генах. Функция гена KIAA0391 в настоящее время неизвестна и не похожа на другие гены с известными функциями.Эти удаленные интервалы содержат потенциальные сайты связывания факторов транскрипции. Эти делеции отдельно или в сочетании с генетическим фоном, унаследованным от отца, могут объяснить более тяжелый фенотип, наблюдаемый у пробанда.

Большинство исследований по сцеплению и неравновесному сцеплению сообщают лишь о слабых доказательствах наличия локуса шизофрении в проксимальной области хромосомы 14q человека. 6 Однако при использовании скрининга генома с использованием непараметрического анализа сцепления две группы предположили значимое сцепление с маркерами D14S79 (p=0.01) и D14S306 (p=0,005) в 14q13, 19, 20 , что свидетельствует о локусе чувствительности в 14q13. Недавно, используя наборы данных идентификации по происхождению 30 пораженных сибсов в 21 родословной из предыдущего исследования Blouin et al , 20 и модифицированного алгоритма многоточечного непараметрического сцепления, 21 свидетельствуют о совместном использовании двух аллелей в 8p21 в сочетании с одним аллелем на хромосоме 14 между D14S1280 и D14S306 был обнаружен среди пораженных пар сибсов со спектром шизофрении. 7 Эти данные свидетельствуют о том, что локус восприимчивости в 14q13 действовал в сочетании с другими локусами шизофрении, такими как 8p21, у обследованных пациентов. Ген NPAS3 находится в пределах этого интервала и, следовательно, может быть геном предрасположенности, играющим важную роль в причине шизофрении. Случаи делеции проксимальной хромосомы 14q, зарегистрированные на сегодняшний день, не описывают каких-либо симптомов психического заболевания. 9, 22– 25 Это может быть связано с тем, что эти зарегистрированные пациенты умерли новорожденными или в раннем детстве или были слишком молоды, чтобы проявлять такие черты.Кроме того, интервалы делеции могут не распространяться на ген NPAS3 .

Из заболеваний, локализованных на сегодняшний день в хромосоме 14q13, только болезнь Фара (идиопатическая кальцификация базальных ганглиев) была связана с нейропсихиатрическими проблемами. 26 Возраст начала идиопатической кальцификации базальных ганглиев составляет от 30 до 60 лет и проявляется у пациентов дизартрией, экстрапирамидными симптомами и атаксией. Центральная нервная система подвергается кальцификации в таких областях, как бледный шар, скорлупа, хвостатое ядро, зубчатая кость, таламус, белое вещество головного мозга и мозжечок, что предположительно приводит к прогрессирующей дистонии, паркинсонизму и психоневрологическим проявлениям, таким как шизофрения или шизофреноформный психоз. .Из пациентов, у которых было выявлено значительное сцепление заболевания с хромосомой 14q13, только у одного был шизофрениформный психоз и спектр болезни Фара. 26 Наши субъекты не имеют общих черт с пациентами с болезнью Фара, демонстрирующими сцепление с хромосомой 14q13, за исключением спектра шизофрении. Мы не смогли определить, преобладала ли кальцификация центральной нервной системы у наших испытуемых.

На хромосоме 9q34 точка разрыва была определена в пределах 100 т.п.н.В течение этого интервала ни один ген не был нарушен. Хотя предполагается, что хромосома 9q содержит ген(ы) предрасположенности к шизофрении, 5 ни один из зарегистрированных генов в интервале точки разрыва 9q34 у наших субъектов не оказался вероятным кандидатом на шизофрению. Нельзя исключить возможность эффектов положения, оказываемых на экспрессию соседних генов в точках разрыва. Были доказательства слабой связи гена NMDAR1 (NM_000832) на хромосоме 9q34 с шизофренией в южноафриканском племени банту. 27 Рецептор NMDAR1 функционирует в глутаминергическом пути, и у мышей, несущих гипоморфный аллель, было показано, что он приводит к шизофреноподобному поведению, которое можно лечить галоперидолом. 28 Однако исследование последовательностей в пределах 1 Мб интервала точки разрыва 9q34 показало, что ген NMDAR1 не располагался внутри этого интервала. Существует один отчет о 28-летнем мужчине с умственной отсталостью, шизофренией, низким ростом, короткой перепончатой ​​шеей, дисморфическим лицом и легкими аномалиями пальцев, у которого была del(9)(q32q34.1). 29 Интервал делеции у этого пациента еще не охарактеризован, и очаг шизофрении у этого пациента еще не идентифицирован.

Таким образом, мы обнаружили, что ген NPAS3 нарушен в семье из двух поколений со спектром шизофрении. Предполагается, что ген NPAS3 является геном восприимчивости, вносящим вклад в развитие психических заболеваний, наблюдаемых в этой семье. Нельзя исключать и другие возможности, такие как психическое заболевание как неспецифическое последствие умственной задержки, пересечение точки разрыва транслокации является результатом случайности, или местонахождение восприимчивости близко, но не на месте соединения точки разрыва.Чтобы подтвердить роль NPAS3 как гена предрасположенности к шизофрении, необходимы ассоциативные исследования в более крупных выборках случай-контроль и анализ мутаций.

Благодарности

Альтернативные кДНК транскриптов NPAS3 представлены в Genbank (номер доступа Genbank AY157302, AY157303). Мы благодарим Патрицию О’Брайен за сортировку клеточных линий потоком. Мы благодарны семье за ​​их согласие на это исследование. Мы также благодарим доктора Бенджамина Пикарда за полезные обсуждения.Это исследование финансировалось за счет гранта 6-FYO1-267 от March of Dimes Birth Defects Foundation для DWC. DK имеет стипендию Фонда медицинских исследований Альберты, Канадского института исследований в области здравоохранения и стипендии Уолтера Х. Джонса.

ССЫЛКИ

  1. Всемирная организация здравоохранения . Международная классификация болезней . 10-е изд. Женева: ВОЗ, 1994.

  2. Американская психиатрическая ассоциация . Руководство по диагностике и статистике психических расстройств . 4-е изд. Вашингтон, округ Колумбия: Американская психиатрическая пресса, 1994.

    .
  3. Робинс Л.Н. , Хельцер Дж. Э., Вайсман М. М., Орвашель Х., Грюнберг Э., Берк Дж. Д. мл., Регьер Д. А. Распространенность конкретных психических расстройств в течение жизни в трех местах. Arch General Psychiatry 1984; 41: 949–58.

  4. Лихтерманн Д , Карбе Э., Майер В.Генетическая эпидемиология шизофрении и расстройств шизофренического спектра. Eur Arch Psychiatry Clin Neurosci 2000; 250: 304–10.

  5. Барон М . Генетика шизофрении и новое тысячелетие: прогресс и подводные камни. Am J Hum Genet2001; 68: 299–312.

  6. Craddock N , Lendon C. Chromosome Workshop: хромосомы 11, 14 и 15. Am J Med Genet1999;88:244–54.

  7. Чиу Ю.Ф. , МакГрат Дж.А., Торнквист М.Х., Волынец П.С., Нештадт Г., Шварц К.Л., Лассетер В.К., Лян К.Я., Пулвер А.Е. Генетическая гетерогенность при шизофрении. II. Условный анализ пораженных шизофренией пар братьев и сестер свидетельствует о взаимодействии между маркерами на хромосомах 8p и 14q. Мол психиатрия 2002; 7: 658–64.

  8. Кук П.Дж. , Робсон Э.Б., Бактон К.Е., Слотер К.А., Грей Д.Е., Бланк К.Е., Джеймс Ф.Е., Ридлер М.А., Инсли Дж., Халтен М.Сегрегация ABO, AK1 и ACON в семьях с аномалиями хромосомы 9. Ann Hum Genet1978;41:365–77.

  9. Камнасаран Д. , О’Брайен П.С., Шуффенхауэр С., Куоррелл О., Лупски Дж.Р., Грамматико П., Фергюсон-Смит М.А., Кокс Д.В. Определение точек разрыва проксимальных перестроек хромосомы 14q у девяти пациентов с использованием хромосом с сортировкой потоком. Am J Med Genet2001;102:173–82.

  10. Мэллой М.П. , Кокс Д.В., Камнасаран Д., Фергюсон-Смит М.А., Пикард Б.С., Портеус Д.Дж., Блэквуд Д.Р., Мьюир В.Дж.Картирование точек разрыва хромосом с использованием fibre-FISH в семье с транслокационной хромосомой t(9;14)(q34q13) и психическим заболеванием. 8-й Всемирный конгресс по психиатрической генетике. Резюме P327 Am J Med Genet2000; 96: 551–552.

  11. Экипажи ST , Вентилятор CM. Память о вещах PAS: регуляция развития белками bHLH-PAS. Curr Opin Genet Dev1999;9:580–7.

  12. Экипажи ST .Контроль развития и транскрипции клеточного клона с помощью белков bHLH-PAS. Гены Dev1998;12:607–20.

  13. Гарсия Дж. А. , Чжан Д., Эстилл С. Дж., Михнофф С., Руттер Дж., Рейк М., Скотт К., Диас-Аррастиа Р., Макнайт С.Л. Нарушение сигнальной и контекстуальной памяти у мышей с дефицитом NPAS2. Наука, 2000; 288:2226–30.

  14. Рейк М. , Гарсия Дж.А., Дадли С., Макнайт С.Л.NPAS2: аналог часов, работающих в переднем мозге млекопитающих. Наука 2001; 293:506–09.

  15. Кокс CJ , Эспиноза Х.М., Маквильямс Б., Чаппелл К., Мортон Л., Хьялт Т.А., Семина Э.В., Амендт Б.А. Дифференциальная регуляция экспрессии генов изоформами PITX2. J Biol Chem2002;277:25001–10.

  16. Brunskill EW , Witte DP, Shreiner AB, Potter SS. Характеристика Npas3, нового основного гена PAS спираль-петля-спираль, экспрессируемого в развивающейся нервной системе мыши.Мех Дев1999; 88: 237–41.

  17. Chrast R , Scott HS, Madani R, Huber L, Wolfer DP, Prinz M, Aguzzi A, Lipp HP, Antonarakis SE. Мыши, трисомные по бактериальной искусственной хромосоме с целенаправленным геном 2 (Sim2), демонстрируют фенотипы, сходные с некоторыми из фенотипов, присутствующих в моделях мышей с частичной трисомией 16 синдрома Дауна. Hum Mol Genet 2000; 9: 1853–64.

  18. Гофф, округ Колумбия , Хеккерс С., Фройденрайх О.Шизофрения. Med Clin North Am2001; 85: 663–89.

  19. Мойзес Х.В. , Ян Л., Кристбьярнарсон Х., Визе С., Байерли В., Макчарди Ф., Арольт В., Блэквуд Д., Лю Х., Шегрен Б., Ашауэр Х.Н., Хву Г.Г., Джанг К., Ливелсли В.Дж., Кеннеди Д.Л., Зоега T, Ivarsson O, Bui MT, Yu MH, Havsteen B, Commenges D, Weissenbach J, Schwinger E, Gottesman II, Pakstis AJ, Wetterberg L, Kidd KK, Helgason T. Международный двухэтапный полногеномный поиск восприимчивости к шизофрении гены.Нат Жене1995;11:321–4.

  20. Блуэн Дж. Л. , Домброски Б. А., Нат С. К., Лассетер В. К., Волынец П. С., Нештадт Г., Торнквист М., Ульрих Г., МакГрат Дж., Каш Л., Ламач М., Томас М. Г., Гериг С., Радхакришна У., Снайдер С. Э., Балк К.Г., Нойфельд К., Шварц К.Л., ДеМарчи Н., Пападимитриу Г.Н., Дикеос Д.Г., Стефанис К.Н., Чакраварти А., Чайлдс Б., Хаусман Д.Е., Казазян Х.Х., Антонаракис С.Е., Пулвер А.Е. Локусы предрасположенности к шизофрении на хромосомах 13q32 и 8p21.Нат Жене1998;20:70–3.

  21. Liang KY , Chiu YF, Beaty TH, Wjst M. Многоточечный анализ с использованием пораженных пар сибсов: включение доказательств сцепления из несвязанных регионов. Genet Epidemiol2001;21:105–22.

  22. Круде Х , Шутц Б., Биберманн Х., фон Мёрс А., Шнабель Д., Нейцель Х., Тоннис Х., Вайз Д., Лафферти А., Шварц С., ДеФеличе М., фон Даймлинг А., ван Ландехем Ф., ДиЛауро Р., Грутерс А.Хореоатетоз, гипотиреоз и легочные изменения из-за гаплонедостаточности NKX2-1 человека. J Clin Invest 2002;109:475–80.

  23. Breedveld GJ , ван Донген Дж.В., Данезино С., Гуала А., Перси А.К., Дюре Л.С., Харпер П., Лазару Л.П., ван дер Линде Х., Джуссе М., Грутерс А., Макдональд М.Е., де Врис Б.Б., Искусство В.Ф., Oostra BA, Krude H, Heutink P. Мутации в TITF-1 связаны с доброкачественной наследственной хореей. Hum Mol Genet2002;11:971–9.

  24. Ramelli GP , Remonda L, Lovblad KO, Hirsiger H, Moser H Аномальная миелинизация у пациента с делецией 14q11.2q13.1. Pediatr Neurol2000;23:170–2.

  25. Das P , Stockton DW, Bauer C, Shaffer LG, D’Souza RN, Wright T, Patel PI Гаплонедостаточность PAX9 связана с аутосомно-доминантной гиподонтией. Гум Жене2002;110:371–6.

  26. Geschwind DH , Логинов М., Штерн Дж.М. Идентификация локуса на хромосоме 14q для идиопатической кальцификации базальных ганглиев (болезнь Фара).Am J Hum Genet1999;65:764–72.

  27. Riley BP , Tahir E, Rajagopalan S, Mogudi-Carter M, Faure S, Weissenbach J, Jenkins T, Williamson R. Исследование сцепления локусов гена субъединицы рецептора N-метил-D-аспартата и шизофрении в южных Африканские семьи, говорящие на языке банту. Психиатр Genet1997;7:57–74.

  28. Мон А.Р. , Гайнетдинов Р.Р., Карон М.Г., Коллер Б.Х.Мыши со сниженной экспрессией рецептора NMDA демонстрируют поведение, связанное с шизофренией. Cell1999;98:427–36.

  29. Park JP , Moeschler JB, Berg SZ, Wurster-Hill DH Шизофрения и умственная отсталость у взрослого мужчины с интерстициальной делецией de novo 9(q32q34.1). J Med Genet1991;28:282–3.

Осложнения беременности могут «включать» гены шизофрении, говорится в исследовании

Эти осложнения, по-видимому, «включают» гены в плаценте, которые связаны с шизофренией, говорят исследователи.

«Осложнения, которые имели значение, были очень серьезными акушерскими осложнениями, такими как преэклампсия, задержка внутриутробного развития и преждевременный разрыв плодных оболочек без индукции родов», — сказал д-р Дэниел Вайнбергер, директор и генеральный директор Института развития мозга Либера в школе Джона Хопкинса. медицины и ведущий автор нового исследования.

«Такого рода стрессы случаются примерно в 15% беременностей, так что это нередкий экологический фактор риска», — добавил он.

В исследовании, опубликованном в понедельник в журнале Nature Medicine, рассматривались генетические профили и истории беременности почти 4000 взрослых из четырех стран: США, Италии, Германии и Японии.Примерно у половины была диагностирована шизофрения, сложное психическое расстройство, которое влияет на настроение, познание, самовыражение, мыслительные процессы и восприятие реальности.

Исследователи обнаружили сильную связь между серьезными осложнениями беременности и развитием шизофрении в более позднем возрасте ребенка. В частности, у взрослых с высоким генетическим риском, у матерей которых были осложнения во время беременности, вероятность развития шизофрении примерно в пять раз выше, чем у лиц с аналогичным генетическим риском, но без осложнений беременности.

«Первое открытие заключалось в том, что эти факторы риска взаимодействуют друг с другом. Генетический риск шизофрении в контексте осложненной беременности оказывает гораздо большее влияние — в четыре-пять раз большее влияние — на предрасположенность к этому заболеванию. у человека разовьется шизофрения, чем если бы они возникали при отсутствии осложненной беременности», — сказал Вайнбергер.

Шизофрения — серьезное психическое расстройство, которым страдает почти 1% населения во всем мире. По данным Национального института психического здоровья, симптомы включают галлюцинации, дисфункциональное мышление, снижение самовыражения или удовольствия от повседневной деятельности и проблемы с памятью.Расстройство, вероятно, вызвано сочетанием генетических и экологических факторов риска, включая среду матки во время беременности. На генетические факторы приходится почти 80% риска развития шизофрении, как показало исследование 2009 года.

«Большинство сложных заболеваний человека, включая шизофрению, связаны как с генетическими, так и с экологическими факторами риска», — сказал Вайнбергер. «И в настоящее время существует очень обширный каталог областей человеческого генома, которые, как было установлено, повышают риск шизофрении.

Во второй части исследования исследователи также проанализировали экспрессию генов в плацентарной ткани пациенток, у матерей которых были или не были осложнения беременности. «включаться» в плаценте пациенток, у которых были осложнения во время беременности.Чем больше плацента показывала признаки стресса, тем больше включалась эта группа генов шизофрении», — сказал Вайнбергер. беременности и удаления продуктов жизнедеятельности. Его роль в развитии ряда заболеваний, вероятно, недооценивается, по словам доктора Дэвида Валле, директора Института генетической медицины МакКьюсика-Натанса при Джоне Хопкинсе, который не участвовал в новом исследовании. .

«Плацента является жизненно важным органом для благополучия плода», — сказал Валле. «Я думаю, что многие исследователи, в том числе и я, пытались понять, как перинатальный стресс может увеличить риск шизофрении. И эта работа предполагает, что посредником в уравнении является плацента.

что вы как бы бьете себя по голове и говорите: «Почему я не подумал об этом?» Это довольно интересно», — добавил он.

Исследователи также обнаружили, что гены, связанные с шизофренией, с большей вероятностью «включаются» в плаценте плодов мужского пола, чем плодов женского пола, что может помочь объяснить, почему у мужчин чаще развивается шизофрения. шизофрении, чем у женщин, по Валье.

«Всегда мы знали, что мужчины имеют более высокий риск развития шизофрении, и обычно она развивается у них в более раннем возрасте», — сказал Валле. «Это может быть способом объяснить повышенный риск».

Новое исследование не первое, связывающее события во время беременности с развитием шизофрении. Исследование 2010 года, например, показало, что женщины, подвергшиеся воздействию вируса гриппа во втором триместре беременности, в три-семь раз чаще рожают детей с шизофренией.

Но новое исследование впервые предполагает, что неблагоприятные события во время беременности могут изменить экспрессию генов в плаценте и, возможно, в плоде, по словам Валле.

«Люди давно знают, что перинатальные проблемы повышают риск шизофрении, — сказал Валле. «Но что интересно в этой работе, так это то, что она предлагает новый и инновационный способ попытаться связать генетический риск с перинатальным риском».

Исследование может также помочь объяснить, почему ряд сложных психических заболеваний, включая шизофрению, синдром дефицита внимания и гиперактивности и аутизм, чаще встречаются у мужчин, по словам Вайнбергера.

«Нам уже давно известно, что все эти поведенческие нарушения развития — шизофрения, аутизм, СДВГ, дислексия и синдром Туретта — в два-четыре раза чаще встречаются у мужчин, чем у женщин, и у нас никогда не было хорошее понимание этого», — сказал Вайнбергер.

«Это говорит о том, что отчасти причина этого увеличения заболеваемости у мужчин связана с относительно большей чувствительностью мужской плаценты к стрессу окружающей среды во время беременности», — добавил он.

Новое исследование не может сказать, бывают ли во время беременности критические периоды, когда плацента более или менее уязвима для стресса, что, по словам Валле, является одним из основных ограничений исследования.

Но, по словам Вайнбергера, результаты могут помочь в проведении исследований биологической основы шизофрении, а также в выявлении лиц, которые могут подвергаться повышенному риску развития шизофрении в более позднем возрасте.

«Это только вершина айсберга», — сказал он. «Нам нужно сделать гораздо больше, чтобы понять генетические программы, которые строят плаценты, которые модифицируют плаценты и которые реагируют на стресс в плаценте. Очевидно, что некоторые гены шизофрении являются частью этого ландшафта.

И если исследователи смогут лучше выявлять людей с повышенным риском шизофрении на раннем этапе, сказал Валле, «возможно, мы сможем предпринять некоторые меры, чтобы помочь снизить их шансы на развитие шизофрении». — Окружающая среда — риск, люди, личность и семья

Гены играют важную роль в возникновении шизофрении, но сами по себе они не вызывают шизофрению. По этой причине многие исследователи шизофрении считают, что шизофрения сама по себе не наследуется, а наследуется только риск расстройства.Они считают, что у людей, унаследовавших риск шизофрении, расстройство разовьется только в том случае, если они будут подвергаться воздействию стрессора из окружающей среды (событие или состояние в окружении человека, которое вызывает болезнь).

Эта теория аналогична теории других медицинских заболеваний, таких как болезни сердца. Например, человек может унаследовать риск сердечных заболеваний, потому что у него или нее есть родители с проблемами сердца. Однако у человека могут развиться или не возникнуть проблемы с сердцем, в зависимости от нескольких факторов окружающей среды, таких как привычки человека в еде и физические упражнения, а также количество ежедневного стресса, который он или она испытывает.

Исследователи шизофрении все еще работают над тем, чтобы выяснить, какие стрессовые факторы окружающей среды могут сочетаться с генетическим риском, вызывающим шизофрению. Этот механизм будет аналогичен тому, как нездоровое питание может сочетаться с генетическим риском вызвать сердечные заболевания.

Биологические стрессоры окружающей среды

Некоторые биологические стрессоры изучались как возможные частичные причины шизофрении. Несколько исследований показывают, что матери больных шизофренией могли подвергаться биологическому стрессу во время беременности.

Например, тяжелые вспышки гриппа, подобные той, что произошла в Англии в 1958 году, были связаны с увеличением числа случаев шизофрении через двадцать-тридцать лет. Вполне возможно, что в это время необычно большое количество нерожденных детей подверглось воздействию вируса гриппа, и это воздействие вызвало аномальное развитие их мозга.

Некоторые из этих детей, возможно, также унаследовали риск шизофрении. Генетический риск в сочетании с воздействием вируса гриппа мог вызвать выраженные симптомы шизофрении, когда ребенок достиг совершеннолетия.Исследования также показывают повышенный уровень шизофрении у людей, родившихся в весенние и зимние месяцы в районах мира с холодными зимами. Дети, рожденные в это время года, с большей вероятностью заразятся гриппом, находясь в утробе матери, потому что в зимние месяцы заболеваемость гриппом выше.

Еще одним ранним фактором стресса окружающей среды, который может сочетаться с генетическим риском вызвать шизофрению, является осложнение во время процесса родов. Исследователи обнаружили, что люди, страдающие шизофренией, чаще страдают осложнениями при рождении (например, нехватка кислорода во время родов), чем люди, не страдающие шизофренией.Однако у большинства детей, рожденных в таких условиях, шизофрения не развивается. Вполне вероятно, что осложнения при рождении вызывают шизофрению только в том случае, если человек также генетически подвержен риску этого расстройства.

Семейный стресс

В свое время многие специалисты в области психического здоровья считали, что шизофрения вызвана семейными проблемами. В частности, многие люди считали, что шизофрения возникла из-за того, что у них холодная и нелюбящая мать. Термин «шизофреногенная мать» был придуман для описания этих матерей, которые предположительно вызвали шизофрению.Нет никаких научных доказательств, подтверждающих эту теорию. Подлая и нелюбящая семья не вызывает шизофрению.

Однако, несмотря на то, что семейный стресс явно не вызывает шизофрению, некоторые исследования показывают, что взаимодействие с членами семьи может повлиять на течение шизофрении, если у человека уже развилась болезнь. Как упоминалось во второй главе, у людей, страдающих шизофренией, обычно бывают периоды, когда их симптомы улучшаются, и периоды, когда их симптомы ухудшаются.Симптомы могут стать настолько серьезными, что человеку придется обратиться в больницу. Некоторые исследования показали, что больные шизофренией, семьи которых настроены враждебно и критикуют их, с большей вероятностью будут госпитализированы и испытают больше периодов ухудшения симптомов.

Смертельное наследство: мать раскрывает науку о трех поколениях психических заболеваний.

Глобус Пекот / Прометей

Страниц: 267 •

978-1-61614-467-8 • Электронная книга • Январь 2012 г. • 18 долларов США.00 • (13,99 фунтов стерлингов)

«Эта честная, ясная книга исследует неотложные проблемы семейной истории и ранней диагностики психических заболеваний. . . . Это будет неоценимо для семей, пытающихся понять свою собственную историю, и для тех, кто был слеп к такой истории». — Эндрю Соломон, лауреат Национальной книжной премии за книгу «Демон полудня: Атлас депрессии». «Грустный, но захватывающий рассказ Виктории Костелло о борьба ее семьи за выздоровление демонстрирует ценность стойкости и настойчивости.— Пол Реберн, бывший главный научный корреспондент AP и автор книги «Познакомившись с ночью: поиски родителей, чтобы понять депрессию и биполярное расстройство у его детей», «Смертельное наследство». . . обязательна к прочтению для всех родителей с семейным анамнезом психических заболеваний, для педиатров и педагогов. . . . Как мать, я благодарна [Костелло] за то, что он дал мне инструменты, чтобы понять риски, которые моя семейная история представляет для моих детей. Но что еще более важно, я благодарен [ей] за ее идеи о том, как предотвратить кризис психического здоровья ребенка и пережить его.— Айелет Уолдман, автор книги «Плохая мать: хроника материнских преступлений, незначительных бедствий и случайных моментов благодати». «Костелло умело сплетает все последние медицинские исследования с вызывающим воспоминания и трогательным рассказом о погружении двух ее сыновей в глубины шизофрении. и депрессии, а затем движется вверх к надежде и выздоровлению. . . . «Смертельное наследство» — это изящный баланс между наукой и мемуарами», — Линда Грей Секстон, автор книги «Половина любви: пережить наследие самоубийства». отдельных и в широких кругах его воздействия на семьи и общины.Сострадательное и убедительное личное путешествие Виктории Костелло по предмету позволяет нам исследовать эти круги так, как это делает она сама. Прочтите ее, потому что уроки очень ценны, и прочтите ее, потому что это история, рассказанная так красиво». — Дебора Блюм, лауреат Пулитцеровской премии, автор книги «Любовь в Гун-парке: Гарри Харлоу и наука о любви». психические заболевания семьи и полезное руководство по выявлению и профилактике. . . . Костелло представляет книгу энергичных личных и фактических исследований.”-Publishers Weekly

Мама и папа дерутся в ваших генах и в вашем мозгу

Откройте для себя , 10 ноября 2008 г.

Ссылка

Иногда лучший способ узнать, как работает мозг, — это посмотреть, что происходит, когда он выходит из строя. Когда одна часть — скопление нейронов или ген, отвечающий за построение мозга, — не делает того, что от нее требуется, мозг может давать сбои. Его неудача может даже обнажить некоторые из скрытых основ разума.

Нейробиологи недавно были очарованы особенно показательной парой редких заболеваний головного мозга. Один из них был обнаружен в 1965 году английским врачом Гарри Энджелманом, которого поразили лица трех детей, которых он лечил. Эти дети всегда улыбались и часто смеялись.

Это заболевание, теперь известное как синдром Ангельмана, поражает примерно 1 из 20 000 детей. Наряду с улыбками и смехом появляются и другие симптомы, некоторые из которых совпадают с симптомами тяжелого аутизма. Многие дети с синдромом Ангельмана никогда не учатся говорить или читать.Они также держат свое тело в движении, часто взмахивая руками. Когда они сосут грудь, они отчаянно сосут, высовывая язык.

Другое столь же редкое заболевание, называемое синдромом Прадера-Вилли, вызывает другой набор симптомов. Младенцы с синдромом Прадера-Вилли очень мало сосут грудь — настолько мало, что их часто приходится кормить через зонд. Однако, как только детям Прадера-Вилли исполняется несколько лет, у них появляется ненасытный аппетит. Они будут пытаться обойти любое препятствие, стоящее между ними и едой.Их яростный голод вызван неисправным гипоталамусом, областью глубоко в мозгу, которая управляет голодом и ростом. Вместо аутизма у многих людей с синдромом Прадера-Вилли во взрослом возрасте развивается шизофрения, они слышат голоса и генерируют параноидальный бред.

Несмотря на различия, Прадер-Вилли и Ангельман — две стороны одной медали. Ученые искали генетическую основу двух синдромов и отследили большинство случаев обоих из-за дефектов в одном и том же месте человеческого генома, участке ДНК на хромосоме 15.Какое заболевание получит ребенок, зависит от того, 15-я хромосома какого родителя несет дефект (клетки каждого человека содержат две генетические копии, одну от матери и одну от отца). Синдром Прадера-Вилли вызывается мутацией в генах отца, которая приводит к удалению фрагмента ДНК на хромосоме 15. Синдром Ангельмана связан с мутацией хромосомы 15 матери.

Если вы вспомните генетику, которую вы изучали в школе, эта закономерность не имеет смысла. Ген есть ген есть ген.Два одинаковых участка ДНК должны оказывать одинаковое влияние на ребенка, независимо от того, от какого родителя он происходит. Но иногда наши гены нарушают правила школьной генетики. Эффекты десятков, а то и сотен генов зависят от того, унаследовали ли вы их от матери или отца.

Различия возникают из-за того, что не все гены активно экспрессируются в наших клетках. Некоторые гены отключаются или замолкают. Каждый раз, когда клетка делится и создает новую копию своей ДНК, специальные ферменты прикрепляют колпачки в определенных местах по длине копии.Эти колпачки не позволяют клетке читать определенные гены, к которым они прикреплены. В результате эти гены не могут производить соответствующие белки. В некоторых случаях колпачки прикреплены только к одной родительской копии гена. Копия другого родителя остается незакрытой и может свободно производить белки.

Это замалчивание родителей известно как импринтинг генов, и оказывается, что оно важно для нашего здоровья. Мутации, изменяющие характер импринтинга, могут иметь большое влияние на наши тела. Например, если клетке не удается запечатлеть один из генов двух родителей, у нее будет два гена, продуцирующих белок, а не один.Клетка сделает в два раза больше копий белка.

Открытие импринтинга генов в 1984 году подняло большой вопрос: почему гены одного из родителей вообще должны быть подавлены? В 1999 году Дэвид Хейг из Гарвардского университета выдвинул поразительную гипотезу. Он предположил, что импринтинг генов является результатом эволюционной борьбы между матерями и отцами за репродуктивный успех. Эта борьба происходит не между самими матерями и отцами, а между генами, которые они передают своим потомкам.Естественный отбор отдает предпочтение генам, которые могут создавать больше копий самих себя. Но лучшая стратегия для отцовских генов отличается от той, которая лучше всего подходит для генов, переносимых матерями.

На протяжении миллионов лет матерям приходилось вкладывать огромное количество времени и сил в своих детей. Инвестиции начинаются еще в утробе матери, когда матери снабжают растущий плод питательными веществами.

Хейг отметил, что требования репродукции вынудили матерей пойти на эволюционный компромисс.Если они много вкладывают в одного ребенка, он или она становится больше и здоровее, и у него больше шансов дожить до взрослой жизни. Но слишком большие вложения в одного ребенка могут подорвать благополучие любых братьев и сестер и поставить под угрозу собственное здоровье матери. Наиболее успешное решение — вкладывать много — но не слишком много — в каждого ребенка.

Отцы не идут на такой компромисс. В результате естественный отбор должен благоприятствовать другой стратегии для их генов. С точки зрения отца, чем больше питательных веществ его ребенок может получить от матери, тем больше вероятность того, что ребенок вырастет здоровым и передаст гены своего отца.

Хейг утверждал, что процесс естественного отбора будет способствовать мутациям в генах отцов, которые увеличивают количество питательных веществ, получаемых младенцами от своих матерей. Гены могут управлять скоростью, с которой растет плод, или они могут делать плаценту более агрессивной, когда она проникает в ткани матери.

Поскольку отцы передавали эти гены, стимулирующие рост, продолжил Хейг, матери могли извлечь выгоду из контрстратегий. У них могут развиться гены, замедляющие быстрый рост их детей, чтобы сохранить свое собственное здоровье в долгосрочной перспективе.Мамы также могут эволюционировать, чтобы импринтировать (деактивировать) свои копии генов, которые ускоряют рост. Гипотеза импринтинга Хейга до сих пор вызывает много споров, но в настоящее время имеется достаточно доказательств, подтверждающих ее.

Что особенно примечательно в импринтированных генах, так это то, что многие из них играют роль в формировании мозга. Некоторые из них, по сути, активны только в головном мозге. Как конфликт между матерями и отцами мог разыграться в наших головах? Два биолога-эволюциониста, Бернард Креспи из Университета Саймона Фрейзера в Канаде и Кристофер Бэдкок из Лондонской школы экономики и политических наук, изучали нарушения импринтинга, такие как синдромы Ангельмана и Прадера-Вилли, чтобы получить некоторые подсказки.Они выдвинули смелую идею: наш разум тоже формируется конфликтом между генами наших родителей.

Креспи и Бэдкок расширяют идеи Хейга за пределы рождения, утверждая, что импринтинг генов мозга может влиять на поведение детей, и это поведение может быть полезным для матерей или отцов. Матери должны распределять ограниченные ресурсы между всеми своими детьми и поэтому отдают предпочтение потомству с умеренными требованиями. Если мать тратит все свое время на уход и заботу об одном ребенке, все остальные ее дети пострадают.

Тем временем отцы могут повысить свой репродуктивный успех, если передадут своим детям гены, которые заставят их получать больше ресурсов от своих матерей. Например, дети могут больше сосать грудь или требовать больше внимания. Импринтинг и подавление этих генов может принести пользу матерям, потому что они могут притупить спрос. Отцы также могли заглушить гены мозга ради собственной эволюционной выгоды.

Каждая из этих новых адаптаций похожа на перетягивание каната в перетягивании каната между родителями. В нормальных условиях каждый рывок может лишь немного сместить поведение ребенка в сторону одного из родителей.Но иногда возникают мутации, которые отключают целые гены от одного родителя. Как будто один из родителей вдруг отпустил веревку, и она полетела в другую сторону.

Синдромы Ангельмана и Прадера-Вилли возникают из-за мутаций импринтированных генов и изменяют поведение именно так, как предсказывали Креспи и Бэдкок. При синдроме Ангельмана гены матери замолкают, позволяя генам отца действовать без каких-либо ограничений. Дети с синдромом Ангельмана стараются сосать грудь больше, чем обычные дети.Улыбки и смех, которые ассоциируются с Ангелманом, также могут исходить из стратегий привлечения внимания, закодированных отцовскими генами.

Прадер-Вилли возникает в результате обратного распада, при котором ДНК отца в том же сегменте хромосомы 15 удаляется. Многие симптомы Прадера-Вилли имеют смысл как преувеличенные версии стратегий, приносящих пользу матерям. Младенцы с синдромом Прадера-Вилли предъявляют мало требований к своим матерям — настолько мало, что рискуют уморить себя голодом. Только после того, как они заканчивают отлучение от груди, появляется их ненасытный голод.

Crespi и Badcock выявили несколько других нарушений импринтинга, которые имеют аналогичную симметрию матери и отца (включая синдром Клайнфельтера, при котором в организме содержится одна или несколько дополнительных копий Х-хромосомы). Что поразительно в них, так это то, что расстройства, связанные с отношением к отцу, имеют тенденцию вызывать аутистические симптомы, в то время как расстройства, связанные с отношением к матери, имеют тенденцию вызывать шизофренические симптомы. Возможно, что аутизм и шизофрения сами по себе частично являются результатом конфликтов между родительскими генами, говорят Креспи и Бэдкок.

Дети с аутизмом, у которого проявляются признаки импринтингового расстройства с преобладанием отца, с большей вероятностью, например, имели плаценту, которая агрессивно росла в утробе матери. На шизофрению, по-видимому, влияют материнские гены, некоторые исследования связывают шизофрению с низким весом при рождении и медленным ростом, оба из которых могут принести пользу матерям.

Одно из самых поразительных различий между аутизмом и шизофренией заключается в том, как они влияют на способность понимать других.Аутичным людям трудно понять, что чувствуют другие люди. С другой стороны, шизофреники иногда слишком хорошо справляются со своей работой. Они могут прийти к выводу, что, например, холодильник разговаривает с ними или что люди замышляют против них заговор.

Crespi и Badcock предполагают, что эти симптомы являются результатом генетического конфликта. Чуткие дети могут видеть, как изматывают своих матерей и как много внимания требуют их братья и сестры. Следовательно, материнские гены должны повышать нашу способность проникать в головы других людей.Отцовские гены, с другой стороны, могут выиграть, уменьшая эти отвлекающие факторы от получения большего количества ресурсов от матерей.

А как насчет остальных? «Между этими крайностями находится нормальное познание», — говорят Креспи и Бэдкок. Тот же самый конфликт, который приводит к аутизму и шизофрении, может действовать во всех нас, так или иначе подталкивая нас в спектре от мозга отца к мозгу матери.

Copyright 2003 Discover Magazine. Перепечатано с разрешения.

Связь между голодом и шизофренией может дать представление о наследственных заболеваниях и состояниях

Архив

2 августа 2006 г.

Более высокий риск шизофрении среди потомков будущих матерей, живущих в условиях голода, может помочь нам понять генетическую основу этого изнурительного психического расстройства, утверждает группа исследователей в комментарии к выпуску JAMA от 2 августа. Это открытие также поддерживает теорию медицинской генетики, согласно которой болезни и состояния могут быть вызваны сотнями различных генетических мутаций в любом количестве генов человека.

Эпидемиологи изучили два крупных голода в 20-м веке: голландскую голодную зиму 1944-45 годов, вызванную нацистской оккупацией во время Второй мировой войны; и голод в Китае в 1959-61 гг., ставший следствием неудавшегося «Большого скачка». Во время обоих голодовок рождаемость резко упала. Кроме того, среди детей, рожденных женщинами, беременными во время голода, заболеваемость шизофренией увеличилась в два раза.

Исследователи полагают, что будущие матери не получали достаточного количества фолиевой кислоты и других жизненно важных микроэлементов во время голода, и этот дефицит привел к появлению новых генетических мутаций с исключительно высокой скоростью.Новые мутации в генах, связанных с работой мозга, могут привести к развитию шизофрении

«Фолаты играют важную роль в генетических процессах — транскрипции и регуляции генов, репликации ДНК и восстановлении поврежденной генетической информации», — объяснил соавтор доктор Джек Макклеллан, доцент психиатрии Вашингтонского университета и медицинский директор Центр изучения и лечения детей в Такоме, штат Вашингтон. «Если в рационе матери отсутствует фолиевая кислота, это может привести к генетическим мутациям у развивающегося плода.

Почти три четверти из примерно 20 000 генов человеческого тела так или иначе участвуют в развитии или функционировании мозга, а около одной четверти — это гены, непосредственно связанные с мозгом, что оставляет множество возможных мест, где новые генетические мутации могут повлиять на мозг. . По словам Макклеллана, поскольку шизофрения берет свое начало в развитии и распределении нейронов, вероятно, в областях генома, связанных с этими процессами, исследователи обнаружат связанные с болезнью мутации.

В дополнение к призывам к будущим исследованиям в этой области, Макклеллан и его соавторы, доктор Эзра Сассер из Колумбийского университета и доктор Мэри-Клэр Кинг, профессор медицинской генетики и геномных наук Американского онкологического общества в Университете Вашингтона, утверждают, что шизофрения является последним в ряду заболеваний, показывающих природу наследования генетических состояний. Общепринятое мнение о психических расстройствах состоит в том, что большинство случаев вызвано несколькими распространенными генетическими мутациями, происходящими в небольшом числе генов.

«Проблема с этой моделью в том, что она не соответствует клиническому опыту», — сказал Кинг. «Исследования семей со многими сложными заболеваниями, такими как рак молочной железы, эпилепсия или наследственная потеря слуха, показывают, что множество различных генетических мутаций во многих разных генах могут привести к каждому заболеванию».

Исследователи в шутку называют эту гипотезу моделью медицинской генетики Анны Карениной — каждая нездоровая семья нездорова по-своему.

Эта альтернативная модель генетики помогает объяснить и другие аспекты шизофрении.Почти во всех популяциях заболевание имеет довольно стабильный уровень заболеваемости. Но в популяциях с материнским голодом этот показатель значительно увеличивается. Если есть много различных возможных мутаций, которые могут вызвать шизофрению, и количество мутаций в популяции увеличивается (например, из-за недоедания), то можно было бы ожидать, что скорость заболевания будет расти, как это было во время двух голодоморов. События.

Кроме того, шизофрения может повлиять на скорость размножения у людей с этим заболеванием — у них часто возникают трудности в развитии и поддержании отношений с другими людьми, поэтому, как правило, у них меньше семей и меньше детей, чем у других людей.Если бы за шизофрению отвечало лишь небольшое количество обычных генетических мутаций, ученые ожидали бы, что со временем они будут становиться все менее и менее распространенными, поскольку у людей с этим заболеванием будет меньше детей, которые будут носителями этих мутаций. Вместо этого риск шизофрении остался примерно на том же уровне, что позволяет предположить, что новые генетические мутации могут периодически возникать, вызывая новое заболевание.

Шизофрения передается по наследству, но у большинства людей с этим заболеванием нет близких родственников с шизофренией.Многим больным шизофренией их болезнь кажется неожиданной. Эта модель также предполагает, что новые, разные мутации появляются в разных семьях, сказал Макклеллан, и могут продолжаться в течение нескольких поколений, прежде чем исчезнуть. Это может затруднить определение того, какие генетические мутации вызывают заболевание.

«Обычно, если вы ищете причину болезни, вы собираете всех, у кого есть эта болезнь, и ищете общие для них мутации», — сказал Макклеллан. «Возможно, поэтому было так трудно найти генетическую основу шизофрении.Причина может быть разной от одного случая к другому».

Исследователи надеются использовать инструменты геномики, чтобы узнать больше о генетических мутациях, которые могут быть причиной шизофрении. Они были приглашены сотрудниками из Китая для изучения выживших после китайского голода 1959-61 годов.

###

.

Добавить комментарий

Ваш адрес email не будет опубликован.