Содержание

ГЛИЦИН Д3 12 табл быстрорастворимые

17.07.2019

У нас ребенку прописали курс гормона роста. Мы несколько аптек перепробовали, и всегда анализы у сына не сильно менялись. Наконец то дал Бог купить Джинотропин у вас, вы даже не представляете какой прогресс в росте мы увидели за последние 3 месяца, а все потому, что в отличии от других вы храните и транспортируете его в охлажденных контейнерах. Конечно же мы стали покупать у вас не только его, но и остальные лекарства. Когда аптека относится ответственно к таким сложным для хранения препаратам и не экономит на этом, то такой компании можно доверять. P\S Спасибо вам!

16.10.2019

Нашла только здесь спрей Назонекс на 60 доз, во всех офлайн аптеках на районе предлагали только на 120, мотивируя тем, что флакон на 60 доз не прошёл аккредитацию. Лекарство дорогое, а расход маленький. В еврофарме же и сроки годности хорошие, и нужное лекарство в наличии, и цена «средняя по больнице»  Пункт самовывоза расположен недалеко от метро с удобным временем работы.

Довольна вашим сервисом!

23.12.2019

Когда терпеть приливы стало невозможно, отчаялась и купила рекомендованный врачом Пинеамин. Жалею, что потеряла столько времени, которое могла бы жить нормальной жизнью. Те, кто тяжело переносят климакс, меня поймут. Готов отдать все за спокойный сон. Мне курса хватило на 4,5 месяца. Это меньше, чем обещано производителем, но я все равно очень довольна. Сейчас купила препарат на повторный курс.

03.03.2020

Принимаю эти таблетки год. Как только поставили диагноз подагра врач назначил Азурикс для контроля мочевой кислоты. Читал, что есть дешевый аллопуринол, но врач сказал, что это не мой вариант: заболевание уже запущено, анализы почек очень плохие. Пришлось купить Азурикс. В целом приёмом я доволен. У меня есть знакомый с таким же диагнозом, но он не принимает терапию, экономит, сидит на жесткой диете, иначе сразу жуткие боли в ноге как при переломе.

Я же иногда, признаюсь честно, могу и пару бокалов вина пропустить в честь праздника, и это вообще никак не отражается на моём здоровье.

14.03.2020

Все супер,постоянно заказываю глюкофаж, всегда качестчвенный

Глицин д3 таб.б/раств. №12 бад Малкут нп зао в Серафимовке

Глицин — это важнейшая аминокислота, являющаяся составляющей частью ДНК, которая участвует во многих биохимических процессах, происходящих в человеческом организме. Наибольшую роль она играет в регулировке нервных импульсов, благодаря чему выравнивается психоэмоциональное состояние человека.

Глицин оказывает:

  • оказывает мягкое успокаивающее действие;
  • выводит из состояния сильного нервного напряжения;
  • стимулирует работу головного мозга;
  • увеличивает скорость принятия решений;
  • уменьшает усталость глаз при компьютерном синдроме;
  • положительно влияет на мышечный тонус;
  • способствует социальной адаптации.

Кроме того, глицин способен нейтрализовать токсическое воздействие продуктов распада алкоголя, образуя с ними соединение – ацетилглицин. Это вещество участвует в процессе синтеза белков, гормонов и различных ферментов в организме человека. Таким образом, похмелье проходит гораздо быстрее, и, что немаловажно, и естественно.

Витамин D3 (холикальцеферол) — природный прогомон, стимулирующий рецепторы клеток центральной нервной системы. Биологически активная форма витамина D3 улучшает их состояние и нормализует обмен веществ в головном мозге.

Последние научные исследования доказали, что витамин D3 давно пересек границы действия — регулирование обмена кальция и фосфора в организме (в костях, зубах, ногтях, волосах, мышцах) и стал важным элементом в обеспечении физиологических функций человеческого организма.

Витамин D3 оказывает:

  • увеличивает работоспособность;
  • нормализует сон;
  • повышает настроение, влияя на выработку серотонина — «гормона счастья»;
  • улучшает память и внимание;
  • стимулирует логическое и рациональное мышление;
  • улучшает эластичность сосудов и кровообращение головного мозга; стимулирует иммунитет.

Витамин D3регулирует метаболизм глюкозы и жиров. Дефицит данного

витамина приводит к накоплению жировой ткани, в связи с этим риск развития ожирения.

Дозировка

взрослым по 1 таблетке 1 раз в день после или во время еды, предварительно растворив в 1 стакане (200 мл) питьевой воды комнатной температуры.

Перед применением рекомендуется проконсультироваться с врачом.

Продолжительность приема: 30 дней.

инструкция по применению БАДа, показания и противопоказания

Глицин D3 — это БАД, в состав которого входит глицин и водорастворимый витамин D3. Эти два вещества улучшают функцию ЦНС. Ниже представлена подробная инструкция по применению Глицина Д3.

Описание препарата Глицин Д3 (D3)

БАД содержит в качестве действующих компонентов дневную дозировку глицина и витамина Д3 (холекальциферол).

Глицин — аминокислота, входящая в молекулу ДНК и участвующая во многих биохимических процессах в организме, она регулирует проведение нервных сигналов, в результате чего нормализуется психоэмоциональное состояние человека.

Кроме этого аминокислота:

  • обладает успокаивающем эффектом;
  • помогает справиться со стрессом;
  • повышает умственную работоспособность;
  • улучшает социальную адаптацию;
  • нормализует на тонус мышц;
  • снижает вредное воздействие этанола на организм, помогает быстрее преодолеть похмелье;
  • участвует в биосинтезе протеинов, энзимов и гормонов;
  • устраняет усталость глаз при компьютерном зрительном синдроме.

Витамин Д3 активирует рецепторы ЦНС, улучшает метаболизм веществ в головном мозге. При его дефиците откладывается жировая ткань и повышается вероятность ожирения.

Холекальциферол:

  1. повышает работоспособность и иммунитет организма;
  2. нормализует сон;
  3. повышает настроение, так как стимулирует выработку серотонина;
  4. улучшает эластичность сосудов и мозговой кровоток;
  5. регулирует обмен глюкозы и липидов;
  6. улучшает память, внимание и мышление.

Важно! В состав таблеток входит водорастворимая форма Д3 которая хорошо всасывается в тонкой кишке, так как образует мицеллярные молекулы.

Также в состав биодобавки входят следующие вещества:

  • аспартам;
  • лимонный ангидрид;
  • глюкоза;
  • натрия гидрокарбонат;
  • макрогол;
  • отдушка (экзотик, ананас или апельсин).

к содержанию ↑

Форма выпуска

Биодобавка выпускается в виде шипучих таблеток, весом 3,3 г по 12 штук в коробке. Они бывают 3-х видов:

  • ананас;
  • экзотик;
  • апельсин.
к содержанию ↑

Показания к применению

Глицин Д3 рекомендуется принимать в качестве биодобавке к пище, как дополнительный источник глицина и холикальциферола.

БАД можно пить если наблюдается:

  1. Ослабление памяти и концентрации внимания.
  2. Понижение умственной работоспособности.
  3. Нарушение сна.
  4. Раздражительность.
к содержанию ↑

Инструкция к использованию

Инструкция по применению гласит — пить биодобавку можно принимать вместе с пищей или сразу после нее, предварительно разведя ее в стакане воды.

Суточная дозировка составляет 1 таблетку, длительность приема 1 месяц.

к содержанию ↑

Противопоказания

Глицин d 3 запрещено пить людям с непереносимостью состава таблеток и фенилкетонурией.

к содержанию ↑

Передозировка — что делать?

Принятие большого количества витамина Д3 могут вызвать признаки гипервитаминоза:

  • жидкий стул или запор, сухость и привкус металла во рту, тошнота, рвота, боли в желудке, воспаление поджелудочной железы;
  • повышение уровня кальция в крови и моче;
  • обезвоживание;
  • головная боль;
  • отказ отеды;
  • жажда;
  • учащение ночного и дневного мочеиспускания, увеличения количества мочи, помутнение урины, появление в ней белка и лейкоцитов;
  • сильная слабость;
  • боли в мышцах и костях;
  • психоз;
  • перепады настроения.

При появлении этих симптомов нужно прекратить принимать БАД и обратиться к врачу. При подтверждении гипервитаминоза Д3 показана диета с пониженным содержанием ионов Ca, употребление большего количества жидкости, назначение глюкокортикостероидов, физраствора внутривенно, диуретиков, кальцитонина. Эффективен гемодиализ.

к содержанию ↑

Взаимодействие с другими препаратами

Глицин уменьшает выраженность нежелательных эффектов от антидепрессантов, снотворных средств, антиконвульсантов, нейролептиков и транквилизаторов.

При приеме витамина Д3 с тиазидными мочегонными средствами, бензодиазепинами возрастает вероятность повышения кальция в крови.

Витамин Д3 повышает всасывание препаратов, содержащим фосфор, что может стать причиной гиперфосфатемии.

Индукторы микросомальных ферментов печени могут ускорять метаболизм витамина Д3.

Не стоит одновременно с глицином Д3 принимать БАДы и витаминно-минеральные комплексы, содержащие витамин D, иначе возможно возникновения гипервитаминоза.

Длительный прием витамина Д в комплексе с препаратами, содержащими алюминий и магний, повышает их уровень крови и может стать причиной отравления, особенно у людей, страдающих хронической почечной недостаточностью.

Глицин Д3 можно принимать вместе с ноотропамии анальгетиками.

к содержанию ↑

Особенности применения беременными женщинами и детьми до 14-ти лет

Глицин Д3 нельзя принимать женщинам, ожидающим ребенка и кормящим грудью. БАД рекомендован только лицам старше 18 лет.

к содержанию ↑

Условия и сроки хранения препарата

Хранить БАД надо в темном недосягаемом для детей месте при температуре окружающей среды 8—25 градусов и влажности воздуха максимум 70% в течение 24 месяцев с даты выпуска указанной на упаковке.

Несмотря на то что Глицин Д3 можно купить в аптеке и специализированных магазинах без рецепта не стоит его принимать без предварительной консультации с врачом.

ГЛИЦИН D3 средство для улучшения памяти и повышения работоспособности

Иногда эмоции захлестывают настолько, что вместо тысячи нужных фраз вы произносите короткое: «Слов не хватает». Дело в том, что мозг не успевает генерировать в достаточном количестве образы, которые можно быстро и легко перевести в словесную форму. Одной из частностей, почему так происходит, лингвисты считают недостаток слов.

Сегодня поговорим о том, как увеличить словарный запас в общении и блистать в любом диалоге.

Генеральная зачистка

Чтобы понимать кухню быстрого чтения недостаточно несколько статей. Рекомендуем обратиться к книгам: это источник концентрированной информации, написанной в хронологическом порядке.

Приобретите или скачайте:

  • «Искусство чтения. Как понимать книги» Томас Фостер. Причтите, прежде чем приступать к быстрому чтению. На примере произведений классиков автор учит понимать смысл между строк и воспринимать информацию под другим углом. «Воспоминания, символы, параллели — вот что отличает профессионального читателя от любителя», — говорит Фостер. Принятие другой модели чтения книг поможет лучше запоминать информацию, которая теперь будет основана на ассоциативном мышлении и связана с пережитым опытом.
  • «Скорочтение на практике. Как читать быстро и хорошо запоминать прочитанное» Павел Палагин. Книга была признана миллионами книголюбов и получила недурные отклики. Методики просты и понятны, позволяют овладеть техникой быстрого чтения за несколько недель. Автор жестко критикует нерасторопных читателей, тем самым мотивируя скорей закончить изучение вопроса. На семинарах Палагин, не стесняясь, советует прочесть лишь 25% книги и отбросить остальное за ненужностью. Это утверждение подогревает интерес публики, стремящейся опровергнуть слова автора.
  • «Развитие памяти» Гарри Лорейн. Идеальная книга для тренировки памяти и воображения. После прочтения вы станете лучше воспринимать информацию, запоминать даты и большие числа, играючи продолжать сюжетную линию любого рассказа.

ГЛИЦИСЕД инструкция по применению, цена в аптеках Украины, аналоги, состав, показания | GLICISED таблетки компании «Киевмедпрепарат»

глицин — заменимая аминокислота (естественный метаболит), является нейромедиатором тормозного типа действия и регулятором метаболических процессов в ЦНС, уменьшает психоэмоциональное напряжение, повышает умственную работоспособность, оказывает нейропротекторное, антистрессовое, седативное действие, улучшает метаболические процессы в тканях мозга, нормализует сон, снижает токсическое действие алкоголя. Не вызывает привыкания.

Легко проникает в большинство биологических жидкостей и тканей организма, в том числе в головной мозг. Быстро расщепляется в печени глициноксидазой до воды и углекислого газа. Накопления глицина в тканях не происходит.

функциональные и органические заболевания нервной системы (неврозы, неврозоподобные состояния, вегетососудистая дистония, последствия нейроинфекции, черепно-мозговой травмы, перинатальные и другие формы энцефалопатии, в том числе алкогольного генеза), сопровождающиеся повышенной возбудимостью, эмоциональной нестабильностью, снижением умственной работоспособности, нарушением сна.

Ишемический инсульт и нарушения мозгового кровообращения.

В качестве вспомогательного средства при лечении алкоголизма.

лекарственное средство Глицисед применяют в таблетках или в форме порошка после измельчения таблетки трансбукально (путем размещения за щекой или в ротовой полости) или сублингвально (под язык). Таблетку держат во рту до полного растворения.

Детям в возрасте старше 3 лет, подросткам, взрослым при снижении умственной работоспособности Глицисед назначают по 1 таблетке (100 мг) 2–3 раза в сутки в течение 14–30 дней.

Максимальная суточная доза — 300 мг.

Детям в возрасте старше 3 лет и взрослым с повышенной возбудимостью, эмоциональной лабильностью назначают по 1 таблетке 2–3 раза в сутки, курс лечения — 7–14 дней. При необходимости курс терапии повторяют.

При нарушениях сна назначают по 50–100 мг за 20 мин до сна или непосредственно перед сном.

При ишемическом мозговом инсульте и нарушениях мозгового кровообращения назначают 1 г препарата ретробукально или сублингвально (при необходимости таблетку растереть) в течение первых 3–6 ч после развития инсульта, далее — в течение 1–5 дней по 1 г/сут, затем в течение 6–30 сут — по 1–2 таблетки 3 раза в сутки.

При лечении алкоголизма назначают как вспомогательное средство по 1 таблетке 2–3 раза в сутки в течение 14–30 дней. При необходимости курс лечения повторяют 4–6 раз в год.

индивидуальная непереносимость препарата и повышенная чувствительность к отдельным его компонентам; артериальная гипотензия. Детский возраст до 3 лет.

обычно препарат хорошо переносится. При индивидуальной повышенной чувствительности возможно развитие аллергических реакций, а также сыпи, зуда, крапивницы, ринита, першения в горле, конъюнктивита, слабости.

Со стороны ЖКТ возможно развитие диспептических явлений, в том числе боль в эпигастрии, тошнота.

Со стороны нервной системы отмечали единичные случаи снижения концентрации внимания, головной боли, напряженности, раздражительности.

у пациентов, склонных к артериальной гипотензии, необходимо контролировать уровень АД и в случае необходимости проводить коррекцию дозы препарата — Глицисед назначают в низких дозах и при условии регулярного контроля АД. При снижении АД ниже обычного уровня прием лекарственного средства прекращают.

Применение в период беременности и кормления грудью. Влияние Глициседа на организм в период беременности или кормления грудью детально не исследовали, поэтому применение препарата не рекомендуется.

Дети. Препарат применяют у детей в возрасте старше 3 лет.

Способность влиять на скорость реакции при управлении транспортными средствами или работе с другими механизмами. Необходимо соблюдать осторожность при управлении транспортными средствами или работе с другими механизмами, а также занятии потенциально опасными видами деятельности.

Глицисед снижает токсичность противосудорожных, антипсихотических лекарственных средств, антидепрессантов. При сочетании со снотворными, транквилизаторами и антипсихотическими препаратами усиливается эффект торможения ЦНС.

о клинических проявлениях передозировки сведений нет.

в оригинальной упаковке при температуре не выше 25 °С.

Дата добавления: 02.04.2021 г.

поиск и заказ лекарств через интернет

Интернет-аптека AptStore представляет собой удобный сервис, который пользуется большой популярностью среди населения Москвы и Московской области. В представленном каталоге можно найти любой препарат и совершить покупку всего в пару кликов на максимально простых и выгодных условиях. Настоящие профессионалы помогут пользователям подобрать необходимую продукцию, оформить и осуществить доставку в кратчайшие сроки. Решив совершить покупку в режиме онлайн, клиент сможет самостоятельно оценить все плюсы работы компетентного персонала, удаленного оформления заказа и быстрой доставки.

Ассортимент медикаментов

Аптека предлагает большой выбор лекарственных препаратов. Ассортимент регулярно пополняется с учетом выпуска новых медикаментов, растущего спроса и пожеланий покупателя.

В каталоге всегда можно найти следующие позиции препаратов:

  • лекарства отечественного и зарубежного производства, помогающих при разных недомоганиях и заболеваниях: более 7000 наименований;

  • медицинские приборы и изделия (тонометр, термометр, эластичные бинты, шприцы, фиксаторы и др. ): более 200 видов;

  • косметические и гигиенические средства, необходимые для ухода за телом (шампуни, крема, мыло), включая косметику, оказывающую лечебное воздействие: более 3000 позиций;

  • детская продукция и товары для мамочек, в перечень которых входят средства для ежедневного ухода и специализированная бытовая химия;

  • спортивные товары и здоровое питание: около 250 наименований; 

  • биологически активные добавки для улучшения различных процессов в организме. Эффективные препараты восполняют нехватку витаминов и минералов, что позволяет поддерживать физическое здоровье и эмоциональное состояние на должном уровне: более 1000 наименований;

  • прочие товары и изделия медицинского назначения.

Для удобства поиска все представленные наименования отнесены в соответствующие категории.

Лекарства в аптеках Москвы имеют сертификаты, поэтому о качестве и безопасности можно не волноваться. Aptstore учитывает все факторы, которые способны улучшить качество обслуживания. В стремлении создать удобные условия для поиска и совершения заказа, а также обеспечить клиентов всеми необходимыми препаратами, цена не ставится превыше качества. Особое внимание уделяется условиям и срокам хранения, чтобы каждое лекарство в полной мере соответствовало заявленным характеристикам. 

Преимущества интернет-аптеки

Пользуясь услугами аптека онлайн, клиент получает следующие преимущества:

  • возможность совершить покупку в любое время дня и ночи. Аптека интернет-магазин работает круглые сутки, для заказа потребуется иметь лишь мобильное устройство, либо ноутбук с доступом в интернет. Для этого не нужно ходить по нескольким аптекам в поиске лекарства. Совершить покупку, можно не выходя из дому или не отвлекаясь от рабочего процесса;

  • широкий ассортимент.  Интернет-аптека в Москве предлагает больше лекарственных препаратов нежели в любом даже самом масштабном аптечном киоске. В каталоге можно найти самые редкие медикаменты;

  • высокое качество. Все представленные лекарственные препараты проходят надлежащую и тщательную проверку на соответствие установленным нормам безопасности и эффективности. Каждый товар имеет сертификат;

  • доступная цена. Аптека предлагает препараты по более доступной стоимости, поскольку сотрудничает напрямую с производителями и имеет возможность заказывать крупные партии необходимых лекарств;

  • в режиме онлайн покупатель может не спеша ознакомиться с имеющимися медикаментами, изучить их описание, подобрать для себя наиболее подходящее средство;

  • профессионализм сотрудников. Фармацевты обладают надлежащим опытом работы;

  • отсутствие очередей. Нет необходимости тратить много времени, чтобы совершить покупку;

  • можно заказать товар, которого нет в наличии, оформив предзаказ;

  • оперативная доставка. При наличии товара и в зависимости от того, где находится ближайшая аптекаот покупателя, заказ могут доставить в течение нескольких часов;

  • качественная консультация. При необходимости можно задать интересующие вопросы фармацевту в режиме онлайн и уточнить наличие лекарств в аптеках;

  • регулярно проводятся акции и скидки на разные категории товаров, что позволяет приобрести необходимое средство по привлекательной цене.

Процесс регистрации и личный кабинет 

Чтобы заказать лекарства в аптеке через интернет, нужно пройти простую процедуру регистрации, которая не займет много времени. Для этого потребуется ввести необходимые данные в указанные поля. Из личных сведений потребуются: 

  • имя и фамилия;

  • адрес электронной почты;

  • мобильный номер телефона. 

Также нужно придумать надежный пароль, который по необходимости можно поменять.

Пройдя процедуру регистрации, пользователь попадает в свой личный кабинет, где сохраняется личная информация. По желанию можно загрузить свою фото и указать дополнительные сведения, например, отчество и дату рождения.

В личном кабинете клиент сможет видеть все свои совершенные заказы и их статус. Также имеется категория «Избранное», где можно хранить важные лекарства, чтобы иметь быстрый доступ к ним и не потерять их.

Также имеется кнопка «Мои аптеки». Здесь можно сохранять ссылки на имеющиеся аптеки рядом со мной, в которых удобнее и ближе всего забирать заказ. Как правило, покупатель выбирает те адреса, которые ближе всего находятся к рабочему месту, либо дому.  Аптека с доставкой на дом в Москве, позволит получить товар в кратчайшие срок.

Как сделать заказ

Как уже отмечалось, чтобы найти лекарство в аптеках и сделать заказ, нужно пройти быструю и простую процедуру регистрации. После этого пользователь может открыть каталог с товарами и выбрать необходимые медикаменты. Для удобства поиска можно воспользоваться поисковой строкой. Поисклекарств в аптеках Москвы занимает минимум времени. Когда товар будет выбран, его нужно добавить в корзину. Заранее необходимо определиться с адресом, куда он будет доставлен. После этого клиенту будет предоставлена информация о наличии товара и его количестве. Также можно узнать цену товара по предварительной оплате, либо при получении в аптеке.

После уточнения всех моментов можно нажимать кнопку «Оформить заказ». Перед покупателем появится окно, где он сможет увидеть все сведения о заказе: 

наличие лекарств в аптеках Москвы;

  • номер заказа;

  • содержимое заказа;

  • конечная цена;

  • адрес доставки; 

  • контактные данные.  

Если при выборе товара возникнут вопросы, то клиент сможет получить быструю и полную консультацию по интересующим вопросам в режиме онлайн.

Особенности заказа лекарственных препаратов

Каждый лекарственный препарат имеет инструкцию по применению, противопоказания, показания к использованию и побочные действия. Перед покупкой и приемом препарата нужно обязательно ознакомиться с этими пунктами. 

К тому же настоятельно рекомендуется предварительно осмотреться и проконсультироваться с лечащим врачом. Это касается как маленьких детей, так и взрослых пациентов. Специалист сможет оценить состояние больного, выписать подходящие лекарства и назначить правильную схему приема.

Пациент может самостоятельно установить себе ошибочный диагноз и приобрести совершенно не те товары, после чего могут появиться побочные реакции и ухудшиться состояние. Нередко люди пренебрегают своим здоровьем и не оказывают должную и оперативную помощь организму, что может привести к неблагоприятному исходу. Поэтому важно позаботиться о своевременном медицинском обследовании у профессиональных врачей, что позволит избежать ошибок в выборе медикаментов и самом лечебном процессе, и совершить правильный поиск лекарств в аптеках.

Нюансы доставки и приобретения

Многие ошибочно понимают, что такое аптека с доставкой, полагая, что заказ прибудет прямо на рабочий адрес либо дом, поскольку по такому принципу работает большинство онлайн заведений. Но законодательство запрещает применять такой принцип по отношению к лекарственным препаратам. Доставка осуществляется на любое адрес реального аптечного пункта, который покупатель может выбрать самостоятельно. После этого ему остается прийти по указанному адресу в аптеку рядом и выкупить лекарство.

Клиент может не сомневаться, что он получит именно тот товар, который ему требуется. Например, в разгар гриппа и прочих инфекционных заболеваний человек должен в больном состоянии ходить по нескольким аптекам, расположенных в разных местах, чтобы найти банальные лекарства, поскольку многие из них быстро раскупают. Онлайн аптека Москвы позволяет забронировать необходимые средства. Если на момент заказа медикаментов не будет в наличии, их доставят в самое ближайшее время с аптеки от склада.

Аптека Aptstore: поиск лекарств по Москве и Московской области

Интернет-аптека с доставкой, работающая в режиме реального времени, делает процесс поиска и покупки необходимого товара максимально удобным для своих клиентов. Достаточно знать название товара, чтобы найти его в каталоге, либо через поисковую строку. Остается лишь определиться с предпочтительной лекарственной формой, например, это могут быть таблетки, либо капли. Также нужно уделять внимание размеру упаковки и дозировке. Перед покупкой необходимо уточнить, какие медикаменты можно вернуть либо обменять, а какие не подлежат возврату.

Бывает, когда пользователь не знает, какой именно товар ему нужен. В таком случае поиск наличия лекарств в аптеках Москвы может осуществляться по каталогу. Все товары удобно разделены по категориям.

Онлайн-аптеки: где находятся и как узнать контактные данные 

Аптека со склада Москвы имеет несколько пунктов в разных местах города и области. Регулярно их количество увеличивается, удовлетворяя запросы своих клиентов и делая процесс покупки максимально удобным.

На сайте аптеки Aptstore представлены контактные данные каждой аптечной сети. К тому же, после совершенного заказа покупателю на указанный электронный адрес придет письмо с телефоном филиала. Также доступна информация о рабочем графике в будние и выходные дни, что обязательно стоит учитывать при совершении заказа.

На сайте имеется карта, на которой указаны все адреса онлайн аптеки по Москве и области. Для выбора адреса можно воспользоваться несколькими способами:

  • определить ближний район и конкретный адрес;

  • выбрать аптеку из уже сохраненных адресов в разделе «Избранное»; 

  • определить адрес аптеки с учетом расположения ближней станции метро и времени, которое уйдет на дорогу от станции до аптечного пункта. Это позволит покупателю точно определить время визита в аптеку.

На сайте клиент может видеть наличие того или иного медикамента. Отображается информация о количестве упаковок товара на данный момент. Если их количества недостаточно, то можно начать поиск по аптекам и проверить наличие необходимых средств, либо же оформить предзаказ. В последнем случае доставка будет осуществлена в течение нескольких дней.

Цены

Большинство покупателей отдают предпочтение Aptstore, поскольку это более дешевая аптека в сравнении с другими. Заказать лекарство через аптеку в режиме онлайн можно гораздо дешевле, чем в аптечных пунктах Москвы и Московской области. Именно доступность товаров и большой ассортимент объясняет популярность покупок в режиме онлайн. Количество людей, желающих купить лекарства в аптеках через интернет регулярно увеличивается. Чтобы приобрести медикаменты по максимально низким ценам, стоит посетить каталог аптеки и сделать предзаказ. В таком случае товар доставят в течение 24-72 часов. 

Aptstore часто проводит акции и делает скидки для своих покупателей, что дает еще одну возможность сэкономить. О действующих предложениях можно узнать на официальном сайте.

Глицин: для чего он нужен?

Глицин — это аминокислота и нейромедиатор, участвующий во многих биохимических реакциях. Он способствует улучшению качества сна и помогает в лечении определенных психологических расстройств.

Кроме того, считается, что глицин играет немалую роль в сохранении долголетия, поддержании здоровья костей и суставов, чувствительности к инсулину, здоровье сердечно-сосудистой системы и печени.

Полезные свойства

Глицин — это простая, заменимая аминокислота, которая играет ключевую роль в метаболизме и усвоении питательных веществ (1). Он действует как предшественник ряда важных метаболитов, включая креатин, глутатион, пурины и порфирины (2).  Глицин также участвует в передаче в мозг химических сигналов.

Улучшает качество сна

По данным Центра по контролю и профилактике заболеваний, каждый третий взрослый испытывает проблемы со сном. Низкое качество сна повышает риск развития хронических заболеваний, таких как ожирение, диабет, повышенное артериальное давление, сердечные заболевания и инсульт, не говоря уже о психических расстройствах (3).

Стремясь найти более безопасные альтернативы существующим препаратам для улучшения сна, ученые приступили к изучению влияния глицина на качество сна.

В рандомизированном двойном слепом перекрестном исследовании приняло участие 19 женщин-добровольцев с жалобами на недостаточный сон. Они были разделены на две группы, первая группа за час до сна получала 3 грамма глицина, вторая — плацебо.

Качество сна измерялось с помощью стандартизированных анкет — опросника сна госпиталя Святой Марии и контрольной карты утомления для космическо-авиационной медицины — в которых оценивались субъективные характеристики сна.

По данным анкет было выявлено, что прием глицина оказал значительное воздействие на общий балл по контрольной карте утомления. В частности, участники отмечали, что чувствуют себя «очень живыми», «очень бодрыми», «очень отдохнувшими» и «просыпаются с ясным сознанием».

Кроме того, не было выявлено никаких серьезных нежелательных явлений (4).

В ходе другого исследования ученые изучали воздействие глицина на дневную сонливость, усталость и работоспособность у здоровых людей, чья продолжительность сна была ограничена.

Добровольцев попросили на протяжении трех ночей подряд сократить продолжительность сна на 25 процентов. Перед сном они получали 3 грамма глицина или плацебо. По результатам исследования у группы, принимавшей глицин, значительно снизились показатели усталости, а также наблюдалась тенденция к уменьшению сонливости. Также ученые отметили значительное улучшение показателей теста психомоторной бдительности (5).

Помогает в лечении психических расстройств

Шизофрения — это нарушение мозговой деятельности, связанное с гипофункцией (аномально низкий уровень) N-метил-D-аспарагиновой кислоты (НМДА).

Поскольку глицин обеспечивает оптимальную активность рецептора НМДА, одним из подходов к лечению шизофрении в исследованиях было пероральное введение глицина для увеличения его уровня.

В ходе одного исследования одиннадцать мужчин на протяжении двух недель перорально получали высокую дозу глицина. Сканирование, проведенное через 17 часов после последнего приема глицина, показало значительное увеличение в соотношения глицина/креатина в головном мозге.

В другом исследовании ученые обнаружили, что добавление высокой дозы добавок глицина к антипсихотическим препаратам привело к значительному снижению (23% +/- 8%) негативных симптомов. Также было отмечено улучшение когнитивных процессов и позитивных симптомов. (6)

Глицин помогает при лечении обсессивно-компульсивного расстройства. Обсессивно-компульсивное расстройство (ОКР) — это заболевание, характеризующееся повторяющимися навязчивыми идеями и компульсивным влечением, которое вызывает сильное беспокойство (7).

Перспективные результаты анализа клинического случая показали, что прием добавок глицина может помочь при лечении данного расстройства.

Основное внимание в данном исследовании было направлено на лица с диагностированным ОКР и телесным дисморфическим расстройством — психическим расстройством, при котором человек каждый день на протяжении нескольких часов думает о своих реальных или предполагаемых физических недостатках (8).

Стандартное фармакологическое лечение (такое как прием селективных ингибиторов обратного захвата серотонина) не оказало должного эффекта. Однако прием глицина в течение пяти лет привел к значительному снижению признаков и симптомов как ОКР, так и телесного дисморфического расстройства. При прекращении лечения произошел частичный рецидив (9).

Уменьшает возрастной окислительный стресс

Процесс старения связан с окислительным стрессом — нарушением баланса между выработкой свободных радикалов и антиоксидантной защитой (10). Глутатион играет главную роль в антиоксидантной защите. Если клетки неспособны поддерживать внутриклеточную концентрацию глутатиона, происходит необратимое нарушение их жизнедеятельности.

В ходе исследования 2011 года ученые решили определить, может ли стимулирование синтеза глутатиона его предшественниками — цистеином и глицином — облегчить окислительный стресс.

Окислительный стресс связан со многими хроническими заболеваниями, такими как атеросклероз, рак, диабет, ревматоидный артрит, сердечно-сосудистые заболевания, хроническое воспаление, апоплексия, септический шок и другие дегенеративные заболевания (11).

В этом исследовании приняли участие восемь пожилых (60-75 лет) и восемь более молодых (30-40 лет) добровольцев.

Исследователи пришли к выводу, что введение с пищей предшественников глутатиона — цистеина и глицина — привело к повышению концентрации глутатиона на 94,6%, а также к значительному снижению уровня окислительного стресса и окислительных повреждений (12).

Несмотря на то, что требуется больше исследований, эти результаты свидетельствуют о возможном эффективном способе снижения окислительного стресса у пожилого населения.

Полезен для гликемического контроля при диабете 2 типа

Результаты исследования 2008 года, опубликованного в журнале «Journal of EndocrinologicalInvestigation», показали значительное снижение уровня гликозилированного гемоглобина после приема глицина в течение трех месяцев (по сравнению с группой плацебо).

Также было выявлено значительное снижение уровня рецепторов фактора некроза опухоли I у пациентов, получавших глицин (по сравнению с группой плацебо). Снижение повышенного уровня рецептора фактора некроза опухоли I имеет важное значение, поскольку повышенный уровень связан с высоким риском болезни почек и терминальной стадии хронической почечной недостаточности (13, 14).

Лечение с помощью глицина привлекло к себе внимание исследователей тем, что оно способствует предотвращению повреждений тканей, вызванных хроническим воспалением у пациентов с диабетом 2 типа.

Глицин может защитить от вызванной алкоголем гепатотоксичности. В одном исследовании на протяжении шести недель крысы непрерывно подвергались воздействию этанола, чтобы имитировать клиническую картину и гистопатологию вызванных алкоголем повреждений печени, включая ожирение печени, воспаление и некроз.

В течение двух недель одна группа получала контрольный рацион, а другая — рацион с глицином. Исследователи обнаружили следующее: по сравнению с контрольной группой, у группы, получавшей глицин, значительно снизился показатель печеночной патологии, а также уменьшились симптомы ожирения печени.

Кроме того, у крыс, получавших глицин на 30% быстрее восстанавливалась аспартатаминотрансфераза и аланинаминотрансфераза в сыворотке. Аспартатаминотрансфераза и аланинаминотрансфераза — это ферменты, которые, преимущественно, содержатся в печени. Повышенный уровень этих ферментов сигнализирует о повреждении (15).

Был сделан вывод, что глицин ускоряет процесс восстановления после вызванного этанолом повреждения печени (16).

Побочные эффекты

Судя по всему, глицин хорошо переносится организмом. Были некоторые сообщения о проблемах с ЖКТ, таких как мягкий стул, расстройство желудка, тошнота и рвота.

Рекомендуемая дозировка

Дозировка зависит от заболевания.

В некоторых клинических условиях успешно применялась дозировка 3-5 граммов глицина, принимаемого во время еды.

В некоторых клинических исследованиях та же дозировка глицина перед сном способствовала улучшению качества сна.

Заключение

  1. Что такое глицин?

    Глицин — это аминокислота и нейромедиатор, который, способствует улучшению качества сна и помогает в лечении определенных психологических расстройств, таких как шизофрения.

  2. Для чего нужен глицин?

    Глицин участвует в синтезе ряда важных метаболитов, включая креатин, глутатион, пурины и порфирины.  Также он задействован в передаче в мозг химических сигналов.

    Ученые также сосредоточены на изучении роли глицина в сохранении долголетия, поддержании здоровья костей и суставов, чувствительности к инсулину, здоровье сердечно-сосудистой системы и печени.

Изучить отзывы, а также купить глицин, можно в магазине iHerb.

  • Этот абзац содержит рекламную ссылку. Вы получите от нас скидку при оформлении первого заказа, а магазин выплатит нам небольшой процент от прибыли с вашей покупки. Это позволяет вам сэкономить, а нам поддерживать работу сайта и редакции. Спасибо!

питательных веществ | Бесплатный полнотекстовый | Глицин ослабляет вызванное липополисахаридом острое повреждение легких за счет регулирования инфламмасомы NLRP3 и передачи сигналов NRF2

1. Введение

Острое повреждение легких — частое и тяжелое легочное осложнение критического заболевания, вызванное множеством факторов, таких как пневмония, сепсис, шок и респираторные бактерии или вирусное заражение [1]. В физиологических условиях внутриклеточный гомеостаз и нормальная функция легких поддерживаются защитными системами хозяина, включая слизистый слой и иммунный ответ.Слизистый слой, который в основном состоит из секретируемых муцинов, включая MUC5AC и MUC5B, является первой линией защиты, которая предотвращает контакт клеток-хозяев с содержимым просвета, таким как химические вещества, токсины и патогены [2]. Дисфункция слизи связана с инвазией бактерий, которая, в свою очередь, активирует иммунный ответ, инфильтрацию макрофагов и секрецию провоспалительных цитокинов, таких как фактор некроза опухоли-α (TNF-α), интерлейкин-1β (IL-1β). ) и интерферон-γ (IFN-γ), что приводит к снижению функции легких и проявлению повреждения тканей [3,4].Повышенный уровень липополисахаридов (ЛПС), компонента клеточной стенки грамотрицательных бактерий, наблюдался в плазме и тканях легких клинических пациентов и экспериментальных животных. Соответственно, снижение уровня ЛПС связано с положительным результатом лечения и лучшим прогнозом, что указывает на важную роль ЛПС в развитии заболеваний легких. Ряд рецепторов распознавания патогенов (PRR), таких как Toll-подобные рецепторы (TLR), RIG-I-подобные рецепторы (RLR), рецепторы, активируемые протеазой (PAR), Nod-подобные рецепторы (NLR), лектин C-типа рецепторы, как сообщалось, улавливают патогены, контактирующие с эпителием дыхательных путей, и активируют реакцию хозяина [5].Несколько линий доказательств указывают на то, что LPS может распознаваться TLR4 и индуцирует накопление миелоидного фактора дифференцировки 88 (MYD88), что в конечном итоге приводит к активации ядерного фактора κB (NF-κB) — критического транскрипционного фактора, участвующего в производстве провоспалительные цитокины [6]. Нуклеотид-связывающий домен-подобный рецепторный белок 3 (NLRP3) инфламмасома представляет собой главный внутриклеточный мультипротеиновый комплекс врожденной иммунной системы, который состоит из NOD-подобного рецептора, белка NLRP3, апоптоз-ассоциированного спек-подобного белка (ASC) и procaspase1 [7].Сообщалось, что инфламмасома NLRP3 играет важную роль в воспалительных реакциях во время острого повреждения легких [8,9]. Соответственно, мыши с дефицитом NLRP3 устойчивы к вызванной бактериями летальности [9,10,11], что указывает на важный регулятор заболеваний легких [12]. Помимо воспалительных реакций, клетки-хозяева имеют несколько сигнальных путей, активация которых связана с с выживаемостью клеток в ответ на различные раздражители. Ядерный фактор, связанный с эритроидом-2, фактор 2 (NRF2) — это транскрипционный фактор, участвующий в заболеваниях, связанных с воспалением и окислительным стрессом [13].Активация NRF2 активирует последующие мишени, такие как гемоксигеназа 1 (HO1), NAD (P) H хинондегидрогеназа 1 (NQO1) и глутатион-s-трансфераза α 4 (GSTA4) [14], чтобы уменьшить антиоксидантное повреждение и способствует детоксикация при множественных легочных заболеваниях [15,16]. Удаление NRF2 связано с высокой восприимчивостью к респираторным бактериальным инфекциям [17]. Несмотря на огромные успехи в лечении повреждений легких, терапевтические варианты с высокой эффективностью и меньшими побочными эффектами являются обязательными, учитывая его высокую заболеваемость и смертность во всем мире [18].Аминокислоты, такие как глутамин, аргинин и глицин, привлекают все больше и больше внимания из-за различной биоактивности, например, противовоспалительного и антиоксидантного действия в легких и других тканях [19,20,21,22]. Наше недавнее исследование показало, что предварительная обработка глицином эффективно облегчает повреждение легких, вызванное ЛПС, путем ингибирования воспаления и апоптоза альвеолярных клеток [23]. Тем не менее, лежащий в основе механизм все еще остается неясным. Целью настоящего исследования было проверить гипотезу о том, что добавка глицина ослабляет LPS-индуцированное острое повреждение легких путем регулирования инфламмасомы NLRP3 и передачи сигналов NRF2.

2. Материалы и методы

2.1. Реагенты

LPS (Escherichia coli O55: B5) и глицин были продуктами Sigma (Сент-Луис, Миссури, США). Набор для окрашивания альциановым синим (pH 2,5) был получен от Vector Laboratory (Burlingame, USA). Коммерческий набор для панели воспаления мышей был приобретен у BioLegend (Сан-Диего, США). Праймеры были синтезированы Sangon Biotech Co. (Шанхай, Китай). Набор для экстракции тотальной РНК был приобретен у Aidlab Biotechnologies (Пекин, Китай). FastQuant RT Kit (с gDNase) и SuperReal PreMix Plus (SYBR Green) были приобретены у TIANGEN Biotech (Пекин, Китай).Антитела против GAPDH, актина, фосфора-P65 (p-P65), NLRP3, прокаспазы1, расщепленной каспазы1, NRF2 и Beclin1 были приобретены в Santa Cruz Biotechnology (Санта-Крус, Калифорния, США). Антитела против P65, P62, гена 5, связанного с аутофагией (ATG5), и легкой цепи 3 белка, ассоциированного с микротрубочками (LC3), были продуктами Cell Signaling Technology (Danvers, MA, США). Антитела против TLR4, MYD88, ASC, HO1, NQO1, GSTA4, HSP40, HSP70 и конъюгированные с HRP кроличьи антимышиные и мышиные антикроличьи вторичные антитела были получены от Sangon Biotech Co.(Шанхай, Китай).

2.2. Схема эксперимента

Все эксперименты были одобрены Комитетом по уходу и использованию животных Китайского сельскохозяйственного университета и соответствовали Руководству по уходу и использованию лабораторных животных.

В общей сложности 21 самец мышей C57BL / 6 массой 18 ± 2 г (Huafukang Biotechnology Ltd, Пекин, Китай) содержался в комнате с температурой 23 ± 1 ° C и циклом 12 часов свет / 12 часов темноты. . У мышей был свободный доступ к корму (Huafukang Biotechnology Ltd, Пекин, Китай, No.1022) и питьевой водой. После 1-недельного периода адаптации мышей случайным образом распределяли в одну из трех групп обработки: контрольную группу (CON), группу обработки LPS (группа LPS) и группу предварительной обработки глицином + обработку LPS (группа Gly + LPS). Мыши в группе CON подвергались воздействию 0,9% физиологического раствора в виде аэрозоля (5 мл), в то время как мыши в группе лечения Gly + LPS или группе лечения LPS подвергались воздействию глицина в виде аэрозоля (1000 мг в 5 мл 0,9% физиологического раствора) или равного объема аэрозольного 0,9% физиологический раствор один раз в день в течение 7 дней подряд, на основании нашего пилотного исследования и предыдущего отчета [24].Затем мышей в группе, получавшей LPS или Gly + LPS, подвергали воздействию LPS в виде аэрозоля (5 мг в 5 мл 0,9% физиологического раствора) в течение 30 минут на 8 день эксперимента. Мышей умерщвляли через 24 ч после воздействия LPS. Собирали орбитальную кровь и сыворотку для анализа цитокинов. Доли правого легкого иссекали, промывали предварительно охлажденным фосфатным буферным солевым раствором (PBS), а затем хранили при -80 ° C для последующего анализа.
2.3. Окрашивание альциановым синим

Ткани легких, фиксированные в 4% формальдегиде, обезвоживали, заливали парафином, делали срезы и окрашивали раствором альцианового синего (синий) и ядерно-быстрым красным раствором (красный) в соответствии с инструкциями производителя (Burlingame, США). Срезы от каждой мыши визуализировались слепым наблюдателем и отображались с помощью светового микроскопа, оснащенного морфометрической системой с компьютерной поддержкой.

2.4. Анализ воспалительных цитокинов в сыворотке

Воспалительные цитокины в сыворотке определяли с использованием коммерческого набора для определения воспаления у мышей (BioLegend, Сан-Диего, США) и проточного цитометра CytExpert (Beckman, США) в соответствии с инструкциями производителя. Данные анализировали с помощью программного обеспечения LEGENDplex ™ (BioLegend, Сан-Диего, США).

2,5. Количественная полимеразная цепная реакция в реальном времени (qRT-PCR).
Полную РНК экстрагировали из тканей легких с использованием набора TRIzol в соответствии с инструкциями. КДНК получали обратной транскрипцией общей РНК, которую проводили с помощью набора FastQuant RT Kit (с gDNase). Концентрацию РНК и величину OD260 / 280 измеряли с помощью Nanodrop P330 (Implen, Германия). Целостность тотальной РНК со значением OD260 / 280 1,8–2,0 оценивали с помощью электрофореза в 1% агарозном геле перед проведением экспериментов кПЦР.qRT-PCR выполняли с использованием смеси SYBR green и специфических праймеров для генов-мишеней с помощью системы обнаружения последовательностей ABI-Prism 7500 (Applied Biosystems) в соответствии с инструкциями производителя. Последовательности праймеров, использованные в настоящем исследовании, перечислены в таблице 1. Gapdh использовали в качестве внутреннего контроля. Метод 2 -ΔΔCT использовали для определения кратных изменений уровней мРНК с помощью программного обеспечения Microsoft Excel.
2.6. Вестерн-блоттинг
Ткани легких гомогенизировали в жидком азоте, растворяли и встряхивали в холодном буфере для анализа радиоиммунопреципитации (RIPA) (10 мМ трис-HCl, pH 7.4; 150 мМ NaCl; 10 мМ ЭДТА; 1% НП-40; 0,1% SDS) для экстракции белка. Обилие белка определяли с помощью метода вестерн-блоттинга, как описано ранее [25]. Полосы белка были проявлены с помощью набора для хемилюминесценции (Amersham Biosciences) с использованием мини-системы Image Quant LAS 4000 (GE Healthcare Bio-Sciences). Плотность белковых полос количественно определяли с помощью программного обеспечения ImageJ (GE Healthcare Life Sciences).
2.7. Статистический анализ

Все данные представлены как средние значения ± стандартная ошибка среднего.Результаты анализировали с помощью однофакторного дисперсионного анализа с использованием программного обеспечения SAS, версия 9.1 (SAS Institute Inc., Кэри, Северная Каролина, США). Различия между средними значениями определяли с помощью теста множественного сравнения Стьюдента – Ньюмана – Кеулса. p <0,05 было принято для обозначения статистической значимости.

4. Обсуждение

В настоящем исследовании мы обнаружили, что глицин предотвращает вызванное воздействием ЛПС аэрозолем снижение муцина и активацию провоспалительных цитокинов. Этот положительный эффект связан с ингибированием сигнального пути инфламмасом NF-κB и NLRP3, а также с восстановлением передачи сигналов NRF2.

Воздействие на эпителий дыхательных путей респираторных патогенов, аллергенов и токсинов связано с дисфункцией эпителия и развитием заболеваний легких. Муцин, продуцируемый бокаловидными клетками, эпителиальными клетками дыхательных путей и слизистыми клетками в подслизистых железах, является одним из основных компонентов линии защиты, которая покрывает клетки дыхательных путей, тем самым предотвращая контакт содержимого просвета с эпителием [26]. Сообщалось, что нарушение регуляции слизистого барьера связано с повреждением легких и патогенезом множественных заболеваний легких [27].В настоящем исследовании мышей, предварительно обработанных глицином, подвергали аэрозольному воздействию ЛПС, который, как ранее сообщалось, вызывает повреждение легких [23]. Мы обнаружили, что введение глицина предотвращает LPS-индуцированное подавление муцина как на уровне белка, так и на уровне мРНК, что согласуется с предыдущими исследованиями [28,29]. Это уменьшение муцина после лечения ЛПС способствует контакту факторов риска с эпителиальными клетками, тем самым способствуя дисфункции респираторного барьера и воспалительным реакциям [30,31,32]. Как и ожидалось, у мышей, получавших LPS, были повышенные уровни белков провоспалительных цитокинов, таких как TNF-α, IFN-β, IFN-γ, GM-CSF, и интерлейкинов, таких как IL-1β, IL-17A, IL-23, IL. -27, IL-12p70 и IL-6 в сыворотке, что указывает на возникновение повреждения легких в ответ на введение ЛПС в виде аэрозоля. Интересно, что мы обнаружили, что эти изменения после провокации LPS были значительно ослаблены введением глицина, что указывает на защитный эффект глицина при повреждении легких. NF-κB является важным транскрипционным фактором, функция которого связана с биосинтезом провоспалительных цитокинов [33].Чтобы исследовать возможное участие передачи сигналов NF-κB в наблюдаемых благоприятных эффектах, был проведен вестерн-блоттинг, и результат показал, что предварительная обработка глицином отменяла LPS-индуцированную активацию NF-κB, что указывает на регулирующий эффект глицина. Хорошо известно, что TLR4 / MYD88 отвечает за активацию передачи сигналов NF-κB в ответ на бактериальную инфекцию в различных условиях [33]. Однако в нашем исследовании этого не произошло, поскольку на содержание белков TLR4 и MYD88 не влиял LPS.Исследования in vivo и in vitro показали, что фосфорилирование p38MAPK является другим белком, ответственным за NF-κB-зависимые воспалительные реакции и секрецию цитокинов [34,35,36]. Необходимы дальнейшие исследования, чтобы ответить на вопрос, участвует ли p38MAPK в этом защитном эффекте и способствует ли ему. Недавние исследования показали, что активация инфламмасомы NLRP3 является критическим медиатором, ответственным за созревание IL-1β для развития острого повреждения легких [8 , 9]. Этот эффект был подтвержден в нашем исследовании, о чем свидетельствуют повышенные уровни белка NLRP3, ASC, расщепленной каспазы1 и повышенного уровня IL-1β.Важно отметить, что эти эффекты ослаблялись введением глицина, что указывает на регулирующий эффект глицина у мышей, зараженных LPS. Сообщалось, что накопление ROS активирует инфламмасому NLRP3 и нижестоящие мишени, включая каспазу1 и IL-1β, один из основных цитокинов, связанных с повреждением легких как у клинических пациентов, так и у экспериментальных животных [12]. Сообщалось, что глицин облегчает повреждение клеток, вызванное АФК, способствуя синтезу глутатиона (GSH), эндогенного антиоксиданта, в эпителиальных клетках кишечника свиней и других тканях [21,37].Добавка глицина может снизить уровень АФК из-за увеличения количества продукта GSH, тем самым способствуя уменьшению инфламмасомы NLRP3 и снижению уровня белка IL-1β в тканях легких. NRF2 — это транскрипционный фактор, связанный с выживанием за счет активации нижестоящих мишеней, таких как HO1, NQO1 и GSTA4 в ответ на различные стрессы [13]. Дефицит передачи сигналов NRF2 приводит к тяжелому повреждению легких мышей в ответ на воздействие LPS [38]. Напротив, повышенные уровни белка NRF2, как сообщалось, облегчают LPS-индуцированное повреждение легких у мышей [39,40].В соответствии с предыдущим сообщением [41], мы обнаружили, что предварительное введение глицина обращало LPS-индуцированное истощение NRF2 и приводило к увеличению уровня белка в генах, участвующих в выживании клеток [42]. В недавнем исследовании авторы показали, что NRF2 является репрессором NF-κB [43]. Наши результаты показали, что индуцированное глицином подавление NF-κB опосредовано, по крайней мере частично, посредством передачи сигналов NRF2. Белки теплового шока, в том числе HSP40 и HSP70, являются негативными регуляторами генерации АФК [44].У мышей с нокаутом HSP70 наблюдалась чрезмерная активация NF-κB и повышенный уровень воспалительных цитокинов в тканях легких [45]. В нашем исследовании введение глицина предотвращало LPS-индуцированное подавление HSP70 и HSP40 как до уровня белка, так и до уровня мРНК, что могло способствовать уменьшению повреждения легких за счет подавления воспалительных реакций и ингибирования апоптоза эпителиальных клеток в тканях легких, как сообщалось ранее [46 Глицин традиционно считается незаменимой аминокислотой из-за его синтеза de novo из серина, холина, треонина и глиоксилата [47, 48].Критическая роль глицина в восстановлении тканей, регуляции метаболизма и антиоксидантной способности признана в последние годы [23,48]. В настоящем исследовании мы наблюдали защитный эффект глицина в отношении острого повреждения легких у мышей путем регулирования сигнального пути инфламмасомы NLRP3 и белков выживания, включая NRF2, HSP40 и HSP70. Это первое исследование, которое связывало глицин и NLRP3 при заболевании легких. Рецептор глицина (GlyR), управляемый глицином хлоридный канал, был идентифицирован в постсинаптических мембранах, печеночных и альвеолярных макрофагах, нейтрофилах и лимфоцитах [49].Важно отметить, что глицин предотвращает LPS-индуцированную эндотоксемию, активируя GlyR в клетках Купфера [49] или клетках паренхимы печени [50]. Однако и ЛПС, и глицин не влияли на обилие белка GlyR, что исключает участие GlyR и его вклад в противовоспалительный эффект, как наблюдалось в настоящем исследовании. Сообщалось, что дисфункция эндоплазматического ретикулума и активация аутофагии связаны с повреждением легких как у людей, так и у животных [51]. Однако мы обнаружили, что лечение LPS не влияло на уровни белков маркеров аутофагии, включая P62, ATG5, LC3 и Beclin1, а также на уровни белка активирующего фактора транскрипции 6 (ATF6), инозит-требующего фермента 1α (IRE1α), и PKR-подобная ER киназа (PERK) — хорошо известные сенсоры для передачи сигналов стресса эндоплазматического ретикулума.Следовательно, и стресс ER, и аутофагия не связаны с защитным действием глицина. Необходимы дополнительные исследования, чтобы раскрыть основные механизмы в будущем, которые могут улучшить наше понимание преимуществ глицина в контексте повреждения легких.

Восстановительный глициновый путь обеспечивает автотрофный рост Desulfovibrio desulfuricans

Используемый штамм и условия культивирования

Desulfovibrio desulfuricans Штамм G11 (DSM 7057) был извлечен из нашей собственной коллекции культур в Лаборатории микробиологии (Университет Вагенингена и исследования).Если не указано иное, его выращивали в стеклянных флаконах объемом 250 мл, содержащих 100 мл аноксической среды. Среда состояла из основной забуференной бикарбонатом среды, содержащей следующие компоненты (в граммах на литр) Na 2 HPO 4 · 2H 2 0, 0,53; КН 2 ПО 4 , 0,41; NH 4 Cl, 0,3; CaCl 2 · 2H 2 0,11; MgCl 2 · 6H 2 0, 0,10; NaCl 0,3; NaHCO 3 , 4,0 и Na 2 S · 9H 2 0, 0.48. Кроме того, были добавлены кислотные и щелочные растворы микроэлементов (оба по 1 мл на литр) и раствор витаминов (0,2 мл на литр). Кислотный раствор микроэлементов содержал (в мМ): FeCl 2 , 7,5; H 3 BO 4 , 1; ZnCl 2 0,5; CuCl 2 , 0,1; MnCl 2 0,5; CoCl 2 0,5; NiCl 2 , 0,1 и HCl, 50. Раствор щелочных микроэлементов содержал (в мМ): Na 2 SeO 3 , 0,1; Na 2 WO 4 , 0.1; Na 2 MoO 4 , 0,1; и NaOH, 10. Раствор витаминов содержал (грамм на литр): биотин 0,02; ниацин 0,2; пиридоксин 0,5; рибофлавин 0,1; тиамин 0,2; цианокобаламин 0,1; п-аминобензойная кислота 0,1 и пантотеновая кислота 0,1 12 . В базальную среду добавляли 20 мМ сульфата, а свободное пространство бутылок заполняли H 2 / CO 2 (1,5 атм, 80:20 об. / Об.), Чтобы получить H 2 в качестве донора электронов и CO 2. в качестве источника углерода для автотрофного роста.Для гетеротрофных (ацетат / H 2 / CO 2 / сульфат) условий в культуры дополнительно вводили 2 мМ ацетата. В гетеротрофные культуры на лактате добавляли 20 мМ лактата в качестве единственного источника энергии с N 2 / CO 2 (1,5 атм, 80:20, об. / Об.) В качестве газовой фазы. В форматотрофные культуры добавляли 20 мМ формиата в качестве углерода и источника энергии с N 2 / CO 2 (1,5 атм, 80:20, об. / Об.) В качестве газовой фазы. Культуры инкубировали при 30 ° C в темноте.

Физиологические исследования и аналитические методы

За ростом в автотрофных и гетеротрофных условиях наблюдали в культурах, выращенных, как указано выше, при встряхивании при 175 об / мин для оптимального газообмена. Использовали 10% инокулят (при 70% экспоненциальной фазы) из культур, выращенных в соответствующих автотрофных и гетеротрофных условиях. Были взяты пробы газа и жидкости для определения оптической плотности при 600 нм (OD 600 ) и концентраций сульфидов, сульфатов, органических кислот и H 2 .Для определения сульфатов и органических кислот аликвоты жидкой пробы объемом 1 мл центрифугировали 5 мин при 10000 g. Концентрации сульфатов определяли с использованием ионного хроматографа Dionex ICS 2100 (Thermo Scientific, Саннивейл, Калифорния), оборудованного колонкой Dionex ™ IonPac ™ AS16 при 30 ° C и детектором проводимости. Тридцать микролитров культуральной жидкости объединяли с 970 мкл внутреннего стандарта (0,25 мМ йодида натрия), и из них вводили 10 мкл. Гидроксид калия (22%) использовали в качестве элюента в многоступенчатом градиенте от 1 до 45 мМ со скоростью потока 0.4 мл в мин. Стандартная кривая была построена так же, как и для пробоподготовки; самая низкая из включенных концентраций была 0,5 мМ сульфата, который все еще можно было обнаружить. Количество органических кислот определяли с помощью жидкостной хроматографии высокого давления с использованием Shimadzu LC-2030C, оборудованного колонкой Metacarb 67H (Agilent Technologies, Санта-Клара, Калифорния), работающей при 45 ° C, с 0,01 NH 2 SO 4 в качестве элюента при скорость потока 0,9 мл / мин. Четыреста микролитров культуральной жидкости объединяли с 600 мкл внутреннего стандарта (30 мМ арабиноза, 0,01 мкл).1 M H 2 SO 4 ) и 30 мкл вводили. Определение органических кислот проводили с помощью детектора RI. Стандартная кривая была построена так же, как и для пробоподготовки; самая низкая включенная концентрация составляла 0,05 мМ как для формиата, так и для ацетата, которые все еще можно было обнаружить. Для измерения содержания сульфидов 10–50 мкл жидких образцов добавляли к 5 мл воды с 4 мМ ZnCl 2 и сразу же измеряли с помощью колориметрического анализа метиленового синего 43 .Водород контролировали с помощью газовой хроматографии с использованием Compact GC 4.0 (Global Analyzer Solutions, Бреда, Нидерланды), оборудованного предварительной колонкой Carboxen 1010 и колонкой Molsieve 5A, работающей при 90 ° C. Детектор ионизации импульсного разряда работал при 110 ° C. В качестве газа-носителя использовался гелий, а в качестве внутреннего стандарта — 5% криптона. Рост контролировали по оптической плотности при 600 нм (OD 600 ) с использованием спектрофотометра Shimadzu UV-1800.

Культуры регулярно проверяли на чистоту.Для этого 1 мл свежей культуры центрифугировали, осадок дважды промывали стерильным ТЕ-буфером. Затем осадок ресуспендировали в 100 мкл ТЕ и 1 мкл использовали в качестве матрицы для ПЦР. ПЦР проводили в реакциях, содержащих 50 мкл реакционного буфера Green GoTaq, 0,2 мМ dNTP, 0,02 ед. Мкл ДНК-полимеразы -1 GoTaq (Promega, Мэдисон, США) и 0,2 мкМ прямого праймера 27 f (5′-AGAGTTTGATCMTGGCTCAG-3 ‘) И 1492r (5′-TACGGYTACCTTGTTACGACTT-3’), нацеленные на ген 16S рРНК (M = A или C, Y = C или T).Была включена ПЦР отрицательного контроля без ДНК-матрицы. Программа амплификации состояла из начальной стадии денатурации при 95 ° C в течение 15 минут, 30 циклов денатурации при 95 ° C в течение 1 минуты, 40 секунд при 52 ° C для отжига и элонгации при 72 ° C в течение 1 минуты, а затем заключительный этап удлинения при 72 ° C в течение 7 мин. Продукты ПЦР очищали с помощью набора Zymo DNA Clean & Concentrator (Zymo Research, Ирвин, Калифорния) и секвенировали секвенированием по Сэнгеру в GATC Biotech (Констанц, Германия). Полученные последовательности проверяли по базе данных NCBI через BLAST 44 .

Влияние различных концентраций аммония на рост было испытано в автотрофных и гетеротрофных условиях (ацетат / H 2 / CO 2 / сульфат), как упомянуто выше, при встряхивании со скоростью 175 об / мин. Были протестированы пять различных концентраций аммония: 0 ×, 0,5 ×, 1 ×, 1,5 × и 2 × выше исходной концентрации (5,6 мМ). Ежедневно отбирали пробы жидкости для определения роста по OD 600 и концентрации свободного аммония с использованием теста Spectroquant Ammonium Test (Merck KGaA, Дармштадт, Германия) в соответствии с инструкциями производителя.Чтобы избежать вмешательства сульфидов в определение аммония, добавляли эквимолярную концентрацию ZnCl 2 с последующим центрифугированием в течение 5 минут при 10000 г , затем супернатант использовали для количественного определения аммония. Для расчетов использовали стандартную кривую от 0 до 3 мг / л -1 аммония, и образцы разбавляли от 10 до 100 раз, чтобы соответствовать пределам обнаружения набора.

Анализ эталонного генома

Для экстракции ДНК 50 мл клеточной культуры, выращенной в вышеупомянутой среде в гетеротрофных условиях (ацетат / H 2 / CO 2 / сульфат), собирали центрифугированием в течение 5 минут при 15000 g. .Осадок клеток промывали фосфатно-солевым буфером (PBS). Полную геномную ДНК экстрагировали с помощью набора для очистки грамположительной ДНК MasterPure ™ (Epicenter, Madison, WI) в соответствии с инструкциями производителя. Качество и количество ДНК проверяли на агарозных гелях и с помощью набора Qubit® RNA Assay Kit во флуорометре Qubit® 2.0 (Life Technologies, Карлсбад, Калифорния). ДНК секвенировали в GATC Biotech (Констанц, Германия) с помощью PacBio RS2. В результате было выполнено 150292 необработанных чтения. Геном был собран с помощью конвейера smartanalysis версии 2.1.1 / SmrtPipe версия рабочего процесса v1.85.133289, с параметрами по умолчанию (см. Дополнительные данные 8 (Params2.xml)). Перекрывающиеся концы полученной сборки были обнаружены с помощью Blastn версии 2.2.31 (стандартные параметры, кроме e , значение 0,0001) 44 и вручную удалены (8870 п.н.). Чтения Illumina использовались для исправления сборки. Всего в GATC Biotech (Констанц, Германия) на Illumina MiSeq секвенировали 842 997 считываний парных концов с длиной считывания 250 п.н. Адаптеры Illumina Trueseq были вырезаны из этих данных с помощью Cutadapt v1.2.1 45 с настройками по умолчанию. После этого было выполнено качественное обрезание с помощью PRINSEQ Lite v0.20.0 46 с минимальной длиной последовательности 50 п.н. и минимальным качеством 30 на обоих концах считывания и в качестве среднего качества. Результирующие чтения были сопоставлены со сборкой PacBio с bowtie2, версия 2.2.9 47 , с параметрами по умолчанию, за исключением максимального размера вставки 1500 bp. Кроме того, чтения, не связанные с отображением, были разделены. Полученный файл SAM был дополнительно преобразован с помощью Samtools версии 1.3.1 48 , а сборка исправлена ​​с помощью Pilon версии 1.22 49 , с опциями — –изменения –– исправить базы. Чтения без отображения были собраны с IDBA_UD 50 и стандартными параметрами. Все контиги, содержание двух оснований которых превышало 80% вместе (например,> 80% А и Т), были исключены из этой сборки. Все другие контиги сравнивали с blastn (настройки по умолчанию, кроме и , значение 0,0001) со сборкой и отбрасывали, если они имели хотя бы одну совпадающую последовательность минимум 50% длины контигов.Все оставшиеся контиги проверялись вручную на предмет их интеграции в сборку.

Аннотации генома выполнялись с помощью внутреннего конвейера 51 . Prodigal v2.6.3 использовался для предсказания последовательностей ДНК, кодирующих белок 52 , InterProScan 5.25–64 для аннотации белков 53 , Aragorn 1.2.38 для предсказания тРНК и тмРНК 54 и RNAmmer v1.2 для предсказания рРНК 55 . CRISPR были аннотированы с помощью CRISPR Recognition Tool v1.2 56 . Номера EC были предсказаны с помощью версии PRIAM, март 2015 г. 57 , а другие числа EC были получены с помощью условий GO результата InterproScan. Углеводно-активные ферменты 58 были предсказаны с помощью dbCAN версии 5.0 59 . Геном был проверен с помощью CheckM 60 на предмет возможных отсутствующих однокопийных маркерных генов (определяемых как присутствующие только один раз в 97% первоначально исследованных геномов). Из 284 однокопийных маркерных генов 282 были обнаружены в одном случае.CheckM не смог идентифицировать лейцил-тРНК синтетазу через домен PFAM PF13603, несмотря на то, что он аннотирован в гене DSVG11_2270. CheckM идентифицировал два экземпляра глутамин-тРНК_лигазы (DSVG11_0970 и DSVG11_3047). Оба белка имеют 76% идентичности, и RNAseq указывает на экспрессию во время роста в автотрофных и гетеротрофных условиях, что делает маловероятным, что один из генов является артефактом. Дупликации тРНК-лигаз / синтетаз были описаны до 61 . Для дальнейшего определения отсутствующих генов в геноме геном был вручную настроен и исследован с помощью Pathway Tools 62 .Были изучены все пути биосинтеза аминокислот, витаминов и нуклеиновых кислот, и были отмечены отсутствующие гены (см. Дополнительную таблицу 1 и дополнительные данные 2). Можно было идентифицировать большинство генов или возможных кандидатов почти на все биосинтетические функции, и только у десяти генов-кандидатов вообще не было. Необработанные чтения были загружены в Европейский нуклеотидный архив (ENA) под номером доступа ERR2111683 для данных Illumina, ERR2111684 для данных PacBio [https://www.ebi.ac.uk/ena/browser/view/PRJEB22313] и SAMEA104278631 для сборки генома.

Анализ мутаций перенесенных культур

Для генотипирования однонуклеотидного полиморфизма (SNP) мы повторно секвенировали с помощью Illumina NovaSeq600 геном как одиночной автотрофной, так и гетеротрофной культуры (ацетат / H 2 / CO 2 / сульфат) через 3 года перемещений. Необработанные чтения были загружены в ENA под номерами доступа от ERR4291999 до ERR4292000 (BioProject PRJEB22313). Повторно секвенированные геномы были сопоставлены с исходным геномом с помощью bowtie2 v.2.3.4.1 47 , а затем преобразовать в отсортированные файлы BAM с помощью samtools v1.6 48 . Дубликаты были отмечены с помощью инструментов picard v.1.124 (http://broadinstitute.github.io/picard/), а SNP были вызваны с помощью HaploTypeCaller из пакета GATK, v4.1.2.0 63 , с набором — — sample-ploidy to 1. Все файлы vcf были объединены с bcftools v1.4 64 . Комбинированный файл vcf был отфильтрован, чтобы сохранить только те SNP, которые имели счетчик чтения> 15 (среднее покрытие чтения в геноме составляло ~ 150–180).

Исследование присутствия пути rGly в других геномах

Идентификация соответствующих генов пути rGly у других организмов была проведена с помощью tblastx по базе данных NCBI NT 65 (загружена 29.04.2020), с помощью e , значение 0,0001 и параметр —max_target_seqs 1000000. Для оперонов GR, GCS и FDH весь оперон использовался для поиска tblastx, а наличие оперона оценивалось с помощью специального скрипта путем проверки совместного появления гены на расстоянии 20 000 п.н. друг от друга.Для всех остальных генов кодирующая последовательность гена использовалась для поиска tblastx. Предполагалось, что ген присутствует, если была идентифицирована 25% гомология между продуктами трансляции нуклеотидных последовательностей.

Чтобы проверить наличие этого пути в комбинации с другими генами FDH, кластеры генов FDH были идентифицированы следующим образом. Для всех других FDH (номера ЕС 1.17.1.9, 1.17.1.10, 1.17.1.11, 1.17.5.3) записи KEGG 66 использовались в качестве отправной точки для идентификации организмов, которые содержат первый исследованный экземпляр этих генов.Если гены были перечислены в записи KEGG, то они также использовались для идентификации. Для EC 1.17.1.9 использовали геном Methylosinus trichosporium OB3b (NZ_ADVE02000001). Аннотация Refseq содержала ген METTRDRAFT_RS0208115 с номером EC 1.17.1.9, и окружающие гены указывали на правильную идентификацию. Гены METTRDRAFT_RS0208105 – METTRDRAFT_RS0208125, включая межгенные области (геномное местоположение 1678535-1684753), были использованы для поиска tblastx. Для EC 1.17.1.10 использовали геном Moorella thermoacetica ATCC 39073 (CP000232). Гены moth_2312-moth 2314 67 , включая межгенные области (геномное местоположение 2432486-2437304), были использованы для поиска tblastx. Для EC 1.17.1.11 использовали геном Gottschalkia acidurici штамм 9a (CP003326). Гены Curi_c29380-Curi_c29410 были упомянуты в KEGG с соответствующей публикацией 68 , но это было расширено до Curi_c29330-Curi_c29410 (геномное местоположение 3074247-3085751).Для EC 1.17.5.3 геном Escherichia coli str. К-12 подл. Использовали MG1655 (NC_000913) с генами b1474-b1476 (геномное расположение 1547401-1551991).

Обнаружение всего пути было основано на наличии минимального количества генов. Путь считался присутствующим, если присутствовал любой из четырех FDH вместе с GCS, лигазой DsvG11_3068 формиат-THF, DsvG11_1518 метенил-THF циклогидролазой и любым из двух необязательных путей: (A) GR и по крайней мере одна из фосфат-ацетилтрансферазы (DsvG11_0941) или ацетаткиназы (DsvG11_0942), или (B) глицингидроксиметилтрансферазы (DsvG11_2276) и SDA (DsvG11_1577).Предполагалось, что GCS присутствует, если три из четырех генов могут быть обнаружены, для GR пять из семи генов (при предположении, что два гена тиоредоксина или любые другие два гена могут присутствовать в другом месте генома), и для FDH EC 1.17.2.3 должны были быть обнаружены четыре из шести генов (при предположении, что два гена кофактора молибдена или любые другие два гена могут присутствовать в другом месте генома). Предполагалось, что FDH EC 1.17.1.9 присутствует, если четыре из пяти генов могут быть обнаружены (поскольку казалось, что либо вспомогательный ген, либо дельта-субъединица регулярно отсутствуют).FDH EC 1.17.1.10 не оценивался, поскольку только два гена были идентифицированы в D. desulfuricans , которые, по-видимому, имели гомологию с другими FDH. Предполагалось, что FDH EC 1.17.1.11 присутствует, если пять из восьми генов могут быть обнаружены (при предположении, что дополнительный белок и два белка для продукции кофактора молибдена или любые другие три гена могут присутствовать в другое геномное расположение). Предполагалось, что FDH EC 1.17.5.3 присутствует, если все три гена могут быть обнаружены.Соответствующие данные можно найти по адресу https://doi.org/10.6084/m9.figshare.8970689.

Транскриптомный анализ

Для секвенирования транскриптома клетки выращивали в автотрофных и двух гетеротрофных условиях (ацетат / H 2 / CO 2 / сульфат и лактат / CO 2 / сульфат) с вышеупомянутой средой. Каждое условие было выполнено в четырех биологических повторностях. Для экстракции тотальной РНК 50 мл культуры собирали примерно в середине экспоненциальной фазы роста: 62, 58 и 66% от максимальной OD 600 для автотрофных, гетеротрофных (ацетат / H 2 / CO 2 / сульфат) и гетеротрофные (лактат / CO 2 / сульфат) условия соответственно.Культуры клеток центрифугировали в течение 10 мин при 10 000 g при 4 ° C и осадок клеток один раз промывали 500 мкл буфера ТЕ, pH 7,4. После второго центрифугирования осадок мгновенно замораживали жидким азотом. Лизис бактериальных клеток и осаждение белков выполняли сразу после этого с использованием модифицированного протокола из набора для очистки грамположительной ДНК MasterPure ™ (Epicenter) следующим образом: инкубацию лизоцима проводили при 37 ° C в течение 20 минут с последующим добавлением 4 мкл β-меркаптоэтанол (48.7%), лизисный буфер и инкубация протеиназы К при 60 ° C в течение 15 мин. Осаждение белков проводили в соответствии с инструкциями производителя. Затем безбелковый супернатант очищали с использованием прибора Maxwell® 16 MDx и набора для очистки LEV simplyRNA (Promega, Madison, WI) в соответствии с техническими условиями производителя. Подготовка библиотеки транскриптомов и секвенирование были выполнены компанией Novogen (HK) Company Limited. Разложение и загрязнение РНК контролировали на 1% агарозных гелях, чистоту РНК проверяли с помощью спектрофотометра NanoPhotometer® (IMPLEN GmbH, Мюнхен, Германия), а концентрацию РНК определяли с помощью набора Qubit® RNA Assay Kit в Qubit® 2.0 Флуорометр (Life Technologies, Карлсбад, Калифорния). Целостность РНК оценивали с помощью набора RNA Nano 6000 Assay Kit системы Agilent Bioanalyzer 2100 (Agilent Technologies, Калифорния, США). Общее количество 3 мкг РНК на образец использовали в качестве исходного материала для препаратов образцов РНК. Подготовка библиотеки для секвенирования специфичного для цепи транскриптома была произведена с использованием набора NEBNext® Ultra ™ Directional RNA Library Prep Kit для Illumina® (NEB, США) в соответствии с рекомендациями производителя. Вкратце, рРНК удаляли с помощью специального набора, который оставлял мРНК, с последующей фрагментацией РНК.КДНК первой цепи синтезировали с использованием случайного гексамерного праймера и обратной транскриптазы M-MuLV, а затем синтез кДНК второй цепи выполняли с использованием ДНК-полимеразы I и РНКазы H. Для того чтобы выбрать фрагменты кДНК длиной предпочтительно 150-200 п.н., фрагменты библиотеки были очищен системой AMPure XP (Beckman Coulter, Беверли, Массачусетс). Качество библиотеки оценивалось с помощью системы Agilent Bioanalyzer 2100. Кластеризацию образцов с индексным кодом выполняли в системе генерации кластеров cBot с использованием набора HiSeq PE Cluster Kit cBot-HS (Illumina) в соответствии с инструкциями производителя.После создания кластера препараты библиотеки были секвенированы на Hiseq 400 (Illumina) и были произведены считывания парных концов. Необработанные чтения были сопоставлены с геномом с помощью Bowtie2 2.3.4.1 47 . Далее файлы были преобразованы с помощью samtools 1.6 48 , а счетчик чтения был получен с помощью htseq-count 0.6.1p1 69 . Анализ дифференциальной экспрессии выполнялся с использованием R версии 3.5.3 70 и DESeq2 1.22.2 71 . Гены со значением p <0.05 и log2-кратное изменение> 1 считались релевантными. Номера EC этих генов были сопоставлены с matplotlib 72 на картах базы данных KEGG 66 для дальнейшего анализа. Необработанные данные были загружены в ENA под номерами доступа от ERR3262781 до ERR3262792 (BioProject PRJEB22313).

Протеомный анализ

Для протеомного анализа клетки культивировали в автотрофных и гетеротрофных (ацетат / H 2 / CO 2 / сульфат) условиях, как описано выше.Каждое условие было выполнено в четырех биологических повторностях. Пятьдесят миллилитров культуры собирали на поздней фазе экспоненциального роста (79% и 76% от максимальной OD 600 для автотрофных и гетеротрофных (ацетат / H 2 / CO 2 / сульфат), соответственно), центрифугировали для 10 мин при 10000 г при 4 ° C, осадок промывали 1 мл PBS и переносили в пробирку Эппендорфа с низким связыванием белка. Затем образцы центрифугировали (10 мин, 4 ° C, 10000 г ) и осадок клеток хранили при -80 ° C.Затем осадки клеток ресуспендировали в 0,5 мл 100 мМ Трис / HCl pH 7,5 и суспензию обрабатывали ультразвуком десять раз с использованием ультразвукового устройства SFX150 Брэнсона, снабженного наконечником 3 мм (Branson, Carouge, CH), 20% амплитуда за 30 циклов. с пульс и 30 с отдых на льду. Неразрушенные клетки и клеточный дебрис удаляли центрифугированием при 10000 g в течение 10 минут при 4 ° C и концентрацию белка в супернатанте измеряли с помощью набора Pierce BCA Protein Assay Kit (Thermo Scientific, Waltham, MA). Десять микрограммов белка загружали на наконечник столика C18 Empore, после чего следовали этап промывки 100 мкл бикарбонатного буфера аммония (ABC) и 100 мкл 5% ацетонитрила в буфере ABC.Дисульфидные связи белков диссоциировали путем инкубации с 10 мМ дитиотреитола в 50 мМ ABC при 60 ° C в течение 1 часа. Карбоксамидометилирование восстановленных цистеинов проводили 20 мМ йодацетамида в 100 мМ Трис (pH 8) при комнатной температуре в темноте в течение 1 часа. После очистки с помощью 100 мкл буфера ABC наконечники предметных столов перемещали в чистые 0,5 мл микроцентрифужные пробирки с низким связыванием и проводили ферментативное расщепление, добавляя сверху 500 нг трипсина в 20 мкл ABC (50 мМ). Расщепление трипсином инкубировали при комнатной температуре при встряхивании при 50 об / мин в течение 18 часов.Чтобы остановить расщепление, к образцам добавляли 10% трифторуксусную кислоту в H 2 O до тех пор, пока pH не упал до 3. Оставшуюся жидкость элюировали в микроцентрифужную пробирку с низким связыванием с последующим элюированием 75 мкл 0,1% муравьиной кислоты. в воде и 5 мкл 50% AcNi / 50% 0,1% муравьиной кислоты. Образцы пептидов анализировали после инъекции (размер образца 18 мкл) на колонке предварительного концентрирования с шариками Magic C18AQ 200A размером 5 мкм 0,10 × 32 мм (Bruker Nederland) при постоянном давлении 270 бар (в результате мин).Затем пептиды переносили на аналитическую колонку Magic C18AQ 200A размером 0,10 × 250 мм (размер гранул 3 мкм) с градиентом ацетонитрила (скорость потока 0,5 мкл в минуту) с помощью Proxeon EASY nanoLC. Применяли градиент 8–33% ацетонитрила в воде с 23,6 мМ муравьиной кислоты в течение 50 минут с последующим быстрым увеличением в течение 3 минут с процентным содержанием ацетонитрила до 80% (с 20% воды и 23,6 мМ муравьиной кислоты в обоих растворах). ацетонитрил и вода) в качестве стадии очистки колонки. Между колонкой предварительного концентрирования и аналитической была включена колонка A P-777 Upchurch Microcross.В сливной линии Microcross электрораспыление (3,5 кВ) подавали непосредственно на элюент через иглу из нержавеющей стали. Спектры FTMS были измерены в положительном режиме полного сканирования между m / z 380 и 1400 на LTQ-Orbitrap XL (Thermo electronic, Сан-Хосе, Калифорния) с высоким разрешением (60 000). CID-фрагментированные сканы MSMS четырех наиболее распространенных 2+ и 3+ заряженных пиков при сканировании FTMS были записаны в зависимом от данных режиме в линейной ловушке (порог MS / MS = 5000, продолжительность исключения 45 с для выбранных м / кв. z 25 ppm).База данных последовательностей белка D. desulfuricans (номер доступа NCBI 631220) использовалась вместе с базой данных загрязняющих веществ, которая, например, содержит последовательности общих загрязняющих веществ: BSA (P02769, предшественник бычьего сывороточного альбумина), трипсин (P00760, бычий), трипсин (P00761, свинья), кератин K22E (P35908, человек), кератин K1C9 (P35527, человек), кератин K2C1 (P04264, человек) и кератин K1CI (P35527, человек). Были включены параметры количественного определения без меток (LFQ), а также соответствия между прогонами.Деамидированные пептиды можно было использовать для количественного определения белка. Остальные параметры количественного анализа оставлены по умолчанию. Фильтрация и дальнейший анализ выходных данных рабочего процесса MaxQuant / Andromeda и анализ содержания идентифицированных белков выполнялись с помощью модуля Perseus 1.5.5.3 (доступного в пакете MaxQuant). Пептиды и белки были допущены к дальнейшему анализу, когда у них была вероятность ложного обнаружения (FDR) <1%, и белки, содержащие по крайней мере два идентифицированных пептида, из которых по крайней мере один был уникальным и один немодифицированным.Обратные совпадения были удалены из вывода MaxQuant. Нормальный логарифм был взят из интенсивностей белка LFQ MS1, полученных из MaxQuant. Значения Zero Log LFQ были заменены значением 4,70 (значение немного ниже, чем наименьшее измеренное значение), чтобы сделать возможными разумные вычисления отношения. Относительное количественное определение белка автотрофных и гетеротрофных (ацетат / H 2 / CO 2 / сульфат) условий было выполнено с помощью Perseus путем применения теста T для двух образцов с использованием колонок интенсивности LFQ, полученных с помощью набора FDR T -test. до 0.05 и S0 установлен на 1 73 . Качество системы nLC-MSMS проверялось с помощью PTXQC 74 с использованием файлов результатов MaxQuant. Данные масс-спектрометрической протеомики были депонированы в Консорциум ProteomeXchange через партнерский репозиторий PRIDE 75,76 с идентификатором набора данных PXD013114.

Стабильное изотопное мечение с помощью

13 C-формиата

Для исследований мечения протеиногенных аминокислот клетки выращивали в трех биологических повторностях в 30 мл бутылях, содержащих 10 мл аноксической среды, приготовленной, как описано выше, с 30 мМ сульфата, H 2 / CO 2 в газовой фазе и с добавлением 75 мМ формиата натрия — 13 C (99% 13 C, Sigma-Aldrich).После достижения стационарной фазы (OD 600 ~ 0,18) клетки собирали центрифугированием 9 мл культуры в течение 5 мин при 10000 g . Клетки промывали один раз дистиллированной водой, а затем ресуспендировали в 6 M HCl для гидролиза при 95 ° C в течение 24 часов. Затем образцы полностью сушили в потоке воздуха при 95 ° C. Гидролизованные образцы ресуспендировали в 1 мл дистиллированной воды и центрифугировали в течение 5 мин при 10 000 g для удаления твердых частиц. Супернатанты с гидролизованными аминокислотами анализировали с помощью UPLC – ионизации электрораспылением (ESI) –MS 77 .Хроматографию выполняли с помощью системы Waters Acquity UPLC (Waters, Etten-Leur, Нидерланды) с использованием обращенно-фазовой колонки HSS T3 C18 (100 × 2,1 мм, 1,8 мкм; Waters, Etten-Leur, Нидерланды). Подвижные фазы представляли собой 0,1% муравьиной кислоты в H 2 O (A) и 0,1% муравьиной кислоты в ацетонитриле (B). Скорость потока составляла 0,4 мл мин. –1 , и использовался следующий градиент: 0–1 мин 99% A; 1–5 мин линейный градиент от 99% A до 82% A; 5–6 мин линейный градиент от 82% A до 1% A; 6–8 мин 1% A; 8–8.5-минутный линейный градиент от 1% A до 99% A; 8,5–11 мин повторного уравновешивания с 99% A. Масс-спектры получали с использованием масс-спектрометра Exactive (Thermo Scientific, Саннивейл, Калифорния) в режиме положительной ионизации с диапазоном сканирования 50,0–300,0 m / z . Спектры регистрировали в течение первых 5 мин градиентов ЖК. Анализ данных выполняли с использованием Xcalibur (Thermo Scientific, Саннивейл, Калифорния). Идентификация аминокислот была основана на времени удерживания и m / z , которые были определены путем анализа стандартов аминокислот (Sigma-Aldrich, St.Луи, штат Мичиган) при тех же условиях.

Динамическое изотопное мечение с помощью

13 C-формиата

Для экспериментов с метаболомикой временного ряда в экспериментах с изотопными индикаторами 13 C клетки выращивали в трех биологических повторностях в стеклянных флаконах объемом 1 л, содержащих 500 мл аноксической среды, приготовленной, как описано выше, с 30 мМ сульфата и встряхивание при 175 об / мин. Свободное пространство над продуктом ежедневно промывали H 2 / CO 2, (80/20% об. / Об.), Чтобы избежать ограничения H 2 и CO 2 .Когда клетки находились в поздней экспоненциальной фазе (73% от максимальной OD 600 ), 20 мл образца брали как момент времени 0 и добавляли 15 мМ 13 C-формиата. После этого отбирали образцы объемом 20 мл через 30 с, а также через 1, 2,5, 4, 5,5, 7, 9 и 24 часа. Образцы немедленно фильтровали через нейлоновые фильтры 0,22 мкм 47 нм (Millipore, HNWPO4700), вставленные в стерильные фильтрующие держатели шприцев (Swinnex, Millipore, SX0004700). Затем фильтры помещали вверх дном в стеклянные чашки Петри, помещенные на сухой лед, содержащий 2 мл экстракционного растворителя (40:40:20 ацетонитрил / метанол / дистиллированная вода).Через 5 минут экстракционный растворитель переносили в 2 мл пробирки Эппендорфа и центрифугировали в течение 5 минут при 14000 g при 4 ° C. Затем супернатант переносили в чистую пробирку Эппендорфа на 2 мл и хранили при -80 ° C. Контроли для измерения фона 13 CO 2 в среде брали через 0,5, 1,5, 3, 4,5, 7,5, 9,2 и 24,5 часа. Для этого отбирали 3 мл жидких образцов и сразу фильтровали через шприцевой фильтр с полиэфирсульфоновой мембраной (MDI, Индия) в анаэробный флакон на 50 мл, содержащий 1 мл 6 н. HCl.Затем измеряли состав газа в свободном пространстве над газовым хроматографом-масс-спектрометром (GC-MS, DSQ MS Thermo Fisher Scientific), состоящим из Trace GC Ultra (Thermo Fisher Scientific, Waltham, MA). Гелий использовался в качестве газа-носителя с расходом 120 мл мин -1 и делением 50. Температура на входе составляла 80 ° C, температура колонки была установлена ​​на уровне 40 ° C, а температура источника ионов составляла 200 ° C. ° C. Фракция 13 CO 2 и 12 CO 2 была получена с помощью масс-спектрометра.Валидация метода проводилась с использованием стандартов с известными смесями 13 CO 2 и 12 CO 2 . Образцы анализировали с помощью высокоэффективной системы ЖХ (ВЭЖХ) –МС / МС, состоящей из системы УВЭЖХ VanquishTM (Thermo Scientific, США), соединенной методом ионизации электрораспылением (отрицательная полярность) с гибридным квадрупольным масс-спектрометром высокого разрешения (Q Exactive orbitrap). , Thermo Scientific, США) работали в режиме полного сканирования для обнаружения целевых соединений на основе их точных масс.Характеристики полной MS – SIM включали разрешение 140 000, цель AGC 1E6, максимальное IT 40 мс и диапазон сканирования от 70 до 1000 m / z . Разделение ЖХ было достигнуто с использованием ACQUITY UPLC BEH C18 (колонка 2,1 × 100 мм, размер частиц 1,7 мкм; номер детали 186002352; серийный номер 02623521115711, Waters). Растворителем A был 97: 3 вода: метанол с 10 мМ трибутиламином, доведенный до pH 8,1-8,2 с помощью 9 мМ уксусной кислоты. Растворитель B представлял собой 100% метанол. Общее время пробега составляло 25 мин со следующим градиентом: 0 мин, 5% B; 2.5 мин, 5% B; 5 мин, 20% B; 7,5 мин, 20% B; 13 мин, 55% B; 15,5 мин, 95% B; 18,5 мин, 95% B; 19 мин, 5% B; 25 мин, 5% B. Скорость потока составляла 200 мкл мин -1 . Температура автосэмплера и колонки составляла 4 и 25 ° C соответственно. Данные метаболомики обрабатывались с помощью Maven для получения хроматограмм извлеченных ионов, а данные корректировались с учетом содержания природных изотопов углерода с помощью AccuCor 78 .

Для улучшения разделения и чувствительности измерения конкретных метаболитов центрального углерода и внутриклеточных аминокислот образцы сначала были дериватизированы либо анилином 79,80 , либо бензилхлорформиатом 81 соответственно.Для дериватизации анилина образцы ресуспендировали в 50 мкл воды, пригодной для ВЭЖХ, 5 мкл анилина (6 M, pH 4,5) и 5 ​​мкл гидрохлорида N- (3-диметиламинопропил) -N’-этилкарбодиимида (200 мг на мл). После 2 ч инкубации при комнатной температуре добавляли 1 мкл триэтиламина, чтобы остановить реакцию. Для дериватизации бензилхлорформиата образцы ресуспендировали в 10 мкл воды для ВЭЖХ, 40 мкл метанола, 5 мкл триэтиламина и 1 мкл бензилхлорформиата и инкубировали при комнатной температуре в течение 30 мин.

Краткое изложение отчета

Дополнительная информация о дизайне исследования доступна в Резюме отчета по исследованию природы, связанном с этой статьей.

Границы | Рибопереключатель глицина в Streptococcus pyogenes контролирует экспрессию гена белка

семейства натрий-аланин-симпортер

Введение

Бактериальные рибопереключатели — это цис- -регуляторных элемента, обнаруженных в 5′-нетранслируемых областях (UTR) мРНК. Регуляция экспрессии генов с помощью рибопереключателей широко распространена у бактерий.Как правило, структуры аптамера внутри рибопереключателя распознают низкомолекулярные лиганды и взаимодействуют с платформой экспрессии. Связывание лиганда способствует формированию исключительной конформации и приводит к регуляции нижестоящих генов. Подавление экспрессии гена достигается за счет терминации транскрипции, ингибирования трансляции посредством секвестрации сайта связывания рибосомы или процессинга мРНК. Связывание лигандов, индуцирующих экспрессию генов, позволяет инициировать удлинение транскрипции или трансляцию.Рибопереключатели из разных классов распознают широкий спектр клеточных соединений, включая коферменты (Winkler W. et al., 2002; Winkler WC et al., 2002; Winkler et al., 2003), катионы магния (Dann et al., 2007) , пурины и их производные (Batey, 2012), молекулы вторичных мессенджеров (Sudarsan et al., 2008) и аминокислоты (Serganov, Patel, 2009). Во многих случаях рибопереключатели контролируют экспрессию генов, участвующих в биосинтезе, деградации или транспорте соответствующего метаболита.

Бактерии зависят от доступности аминокислот для непрерывного биосинтеза белка. Следовательно, экспрессия генов, необходимых для транспорта, синтеза и деградации аминокислот, строго регулируется. Типичными датчиками уровня аминокислот являются элементы Т-бокса и аттенюаторы, расположенные в мРНК. Т-бокс-РНК связывает тРНК и модулирует транскрипцию или трансляцию гена под контролем (Grundy and Henkin, 1993). Аттенюаторы содержат кодоны эффекторной аминокислоты. При низкой концентрации эффектора происходит остановка трансляции и образование антитерминаторной структуры (Yanofsky, 1981).Кроме того, два рибопереключателя могут напрямую связывать аминокислоты. Рибопереключатели лизина контролируют гены, участвующие в биосинтезе лизина и транспорте лизина (Grundy et al., 2003; Rodionov et al., 2003; Sudarsan et al., 2003). Рибопереключатели глицина чаще всего регулируют экспрессию генов системы расщепления глицина, но также были обнаружены выше различных других генов, участвующих в синтезе, преобразовании или транспорте глицина (Barrick et al., 2004). Рибопереключатели глицина широко распространены и были идентифицированы у грамположительных и грамотрицательных бактерий (Barrick and Breaker, 2007).

Streptococcus pyogenes [стрептококк группы А (ГАЗ)] представляет собой грамположительный патоген человека, вызывающий множество заболеваний, от легких самоограничивающихся поверхностных инфекций горла или кожи до опасных для жизни инвазивных заболеваний, включая бактериемию и некротический фасциит. . Распространенными постстрептококковыми аутоиммунными осложнениями являются острый ревматизм и острый постстрептококковый гломерулонефрит. Воздействие заболеваний, вызываемых ГАЗ, особенно велико в условиях ограниченных ресурсов, и в недавней публикации сообщалось о росте глобального бремени инвазивных заболеваний, вызванных ГАЗ (Sims et al., 2016).

Для ограничения применения и распространения антибиотиков и для определения терапевтических целей, специфичных для ГАЗ, исследование процессов регуляции метаболизма может быть очень плодотворным. Рибопереключатели уже были изучены как многообещающие антибактериальные мишени для множества бактерий. Модификация функции рибопереключателя достигается путем введения аналогов лиганда, обычно небольших соединений, которые легко производить и доставлять (Machtel et al., 2016). Для оптимального роста ГАЗ требуется добавка глицина (Levering et al., 2016). Присутствие предполагаемого рибопереключателя глицина в ГАЗ открывает возможность специфического ингибирования метаболизма или транспорта глицина. Таким образом, мы исследовали в этом исследовании регуляцию экспрессии генов с помощью cis -регуляторного элемента с последовательностями, сходными с известными глициновыми рибопереключателями. Один глицин-связывающий аптамер был предсказан в 5′-UTR гена натрий-аланинского симпортерного белка (SAF) в штамме 591 GAS M49. Мы обнаружили, что этот генетический элемент действительно регулирует глицин-зависимую экспрессию гена SAF путем терминации транскрипции. / против прекращения.На втором уровне регуляции стабильность транскрипта гена SAF снижается в присутствии глицина.

Материалы и методы

Бактериальные штаммы и условия культивирования

Штамм 591 стрептококка серотипа M49 группы А был любезно предоставлен R. Lütticken (Ахен, Германия). Все штаммы GAS культивировали в среде с определенным химическим составом (CDM) (van de Rijn and Kessler, 1980) или бульоне Тодда-Хьюитта (Thermo Fisher Scientific, Дармштадт, Германия) с добавлением 0,5% дрожжевого экстракта (Thermo Fisher Scientific, Дармштадт, Германия). (THY), как указано, при 37 ° C с атмосферой 5% CO 2 /20% O 2 . Escherichia coli штамм DH5α (Gibco BRL, Eggenstein, Германия) использовали в качестве хозяина для конструирования, пролиферации и хранения рекомбинантных плазмид. Все штаммов E. coli культивировали на базе бульона Lennox L (Thermo Fisher Scientific, Дармштадт, Германия). Для отбора были добавлены антибиотики в соответствующих концентрациях.

Конструирование рекомбинантных штаммов GAS

Конструкций репортерного гена LUC, контролируемых Riboswitch, получали путем клонирования геномного фрагмента 875 п.н. в MCS pFW11- luc2 (Podbielski et al., 1999). Конструкции репортерного гена LUC, контролируемые промотором, получали путем слияния фрагмента длиной 588 п.н., несущего промоторную область 5 ‘от ribogly до luc2 . Вставки амплифицировали с помощью ПЦР с использованием хромосомной ДНК из штамма 591 GAS M49 в качестве матрицы. Все праймеры, использованные для создания соответствующих фрагментов, перечислены в дополнительной таблице 1. Полученные плазмиды были проверены классическим секвенированием по Сэнгеру (GATC Biotech AG, Констанц, Германия). Штамм 591 GAS M49 трансформировали соответствующими плазмидами.Встраивание рекомбинантных слитых генов в геном подтверждали анализом ПЦР и классическим секвенированием по Сэнгеру (GATC Biotech AG, Констанц, Германия) фрагмента геномной ПЦР.

Количественный анализ активности люциферазы

Для оценки активности люциферазы слитых форм riboswitch- luc репортерные штаммы GAS luc выращивали в CDM с добавлением 0–10 мМ аминокислот глицина, аланина или серина, как указано. Для измерения люминесценции аликвоты клеточных суспензий по 1 мл отбирали с часовыми интервалами, измеряли OD 600 и образцы обрабатывали, как описано Podbielski et al.(1999). Люминесценцию измеряли в течение 15 с на люминометре Lumimat LB 9501 (Berthold Technologies GmbH, Бад-Вильдбад, Германия). Значения RLU в каждый момент времени вычисляли путем вычитания люминесценции в момент времени 0 из люминесценции в момент x. RLU / OD , 600, рассчитывали для нормализации различий в росте.

Экстракция общей РНК

Штаммы стрептококков группы A выращивали в течение 3 часов в CDM, дополненном глицином, как указано. Бактерии немедленно осаждали, быстро замораживали в жидком азоте и хранили при -80 ° C до использования.Бактериальные клетки разрушали в гомогенизаторе (Peqlab Biotechnologie GmbH, Эрланген, Германия). Тотальную РНК из штаммов GAS экстрагировали согласно протоколу, прилагаемому к набору Direct-zol TM RNA MiniPrep (Zymo Research, Irvine). После экстракции РНК обрабатывали кислым фенолом: хлороформом: изоамиловым спиртом (125: 24: 1), pH 4,5 (Thermo Fisher Scientific, Дармштадт, Германия) и ДНКазой TURBO TM (Thermo Fisher Scientific, Дармштадт, Германия) согласно согласно инструкции производителя.РНК хранили при -80 ° C до дальнейшего использования.

Обратная транскрипция с последующей количественной ПЦР (RT-qPCR)

После обработки ДНКазой синтез кДНК выполняли с использованием системы синтеза первой цепи Superscript для ОТ-ПЦР (Invitrogen, Thermo Fisher Scientific, Дармштадт, Германия). Количественную ПЦР-амплификацию проводили с SYBR green (Thermo Fisher Scientific, Дармштадт, Германия) с использованием системы ПЦР в реальном времени ViiA TM 7 (Applied Biosystems, Дармштадт, Германия).Ген 5S рРНК служил внутренним контролем. Относительное выражение рассчитывали с использованием метода 2 -ΔΔct (Schmittgen and Livak, 2008). Все праймеры, используемые для RT-qPCR, перечислены в дополнительной таблице 1.

Нозерн-блот анализ

Образцы

РНК (6 мкг) загружали в денатурирующий 1,5% формальдегидный агарозный гель и разделяли электрофорезом. Стандарты размера (Millennium TM RNA Marker; Thermo Fisher Scientific, Дармштадт, Германия) загружали в тот же гель.РНК наносили на нейтральные нейлоновые мембраны (Roti ® -Nylon 0,2, Carl Roth GmbH & co KG, Карлсруэ, Германия) и сшивали УФ-излучением (UV150 мДж / см 2) . Шаблоны для зондов были созданы с помощью ПЦР с праймерами, перечисленными в дополнительной таблице 1. 5′-конец обратных праймеров содержал последовательность промотора Т7 (CTTAATACGACTCACTATAGGG) для транскрипции in vitro с использованием набора MEGAscript ® T7 (Thermo Fisher Scientific, Дармштадт, Германия).Зонды метили биотином с использованием набора для биотинилирования 3′-конца РНК Pierce TM (Thermo Fisher Scientific, Дармштадт, Германия). Меченные биотином РНК-зонды очищали с использованием набора RNA Clean & Concentrator TM -5 (Zymo Research, Фрайбург, Германия). Мембраны гибридизовали в течение ночи с зондами РНК, комплементарными соответствующим транскриптам, как указано. Стрептавидин IRDye 800CW (LI-COR Biotechnology GmbH, Бад-Хомбург, Германия) использовали для обнаружения, и блот сканировали на Odyssey ® Imager CLX 1283 (LI-COR Biotechnology GmbH, Бад-Хомбург, Германия).

Определение стабильности стенограммы

Штаммы стрептококков группы A выращивали в течение 3 часов в CDM, дополненном глицином, как указано. Синтез РНК подавляли добавлением к культурам рифампицина (1 мг / мл). После добавления рифампицина образцы объемом 5 мл получали через 0, 1, 2, 5 и 10 мин. Образцы добавляли к двум объемам реагента RNAprotect Cell Reagent (Qiagen GmbH, Hilden, Германия), инкубировали при комнатной температуре в течение 5 мин, осаждали центрифугированием и быстро замораживали в жидком азоте.РНК выделяли из образцов, как описано выше, и количество транскриптов определяли с помощью RT-qPCR. Период полужизни транскриптов рассчитывали методом нелинейной регрессии (аппроксимация методом наименьших квадратов, GraphPad Prism).

Статистический анализ

Все эксперименты проводились не менее трех раз или в соответствии с размером выборки (n). Статистическая значимость определялась с помощью тестов, указанных в подписях к соответствующим рисункам.

Результаты

Предполагаемый глициновый рибосвитч опосредует глицин-зависимую экспрессию репортерного гена люциферазы

В предыдущем исследовании мы обнаружили экспрессию 18 предполагаемых рибопереключателей с использованием мозаичных массивов межгенной ДНК (Patenge et al., 2012). Один кандидат на рибопереключатель был идентифицирован после pcrA (Spy49_1007c) и обозначен как sRNASpy4

c. Он принадлежит к семейству Rfam RF00504 глициновых рибопереключателей (Nawrocki et al., 2015) и расположен в 5-первичной области гена натрий-аланинского симпортерного белка семейства (SAF) (Reizer et al., 1994) (Рисунок 1 ). Систему репортерных генов люциферазы (LUC) использовали для определения потенциального ответа на глицин. Геномный фрагмент длиной 889 п.н., содержащий предсказанную последовательность рибопереключателя глицина, и для обеспечения гомологичной рекомбинации его 5′-фланкирующая геномная область была амплифицирована с помощью ПЦР и слита с репортерным геном luc , переносимым pFW11_ luc 2 (Podbielski et al., 1999) (Рисунок 1B). GAS M49 штамм 591 / pFW11_ glyluc 2 выращивали в CDM, содержащем различные концентрации глицина. Глицин необходим для оптимального роста ГАЗ (Levering et al., 2016). Соответственно, рост был плохим в среде без глицина и в среде, содержащей низкую концентрацию глицина (0,01 мМ глицина), по сравнению с ростом в среде, содержащей 0,1-10 мМ глицина (рис. 2А). Активность LUC измеряли с течением времени и нормализовали по плотности клеток, чтобы компенсировать различия в росте (рис. 2B).Максимальная экспрессия репортерного гена наблюдалась через 3 часа роста в отсутствие глицина и в присутствии низких концентраций глицина (0,01–0,1 мМ). В присутствии 10 мМ глицина экспрессия репортерного гена всегда подавлялась. Во время роста 1 мМ глицина умеренная активность LUC может быть обнаружена в фазе экспоненциального роста. Поскольку ген, расположенный ниже предполагаемого рибопереключателя глицина, кодирует предполагаемый натрий-аланинский симпортер, и поскольку аланин и серин структурно сходны с глицином, мы проверили влияние этих двух аминокислот на экспрессию репортерного гена.Рост штамма GAS M49 591 / pFW11_ glyluc 2 в отсутствие серина и в CDM, содержащем 0,01 мМ серина, был медленным по сравнению с ростом в присутствии 0,1-10 мМ серина (рис. 2C). GAS M49 штамм 591 / pFW11_ glyluc 2 рос аналогичным образом в CDM с аланином и без него (рис. 2E). Ни присутствие серина, ни аланина не влияло на экспрессию репортерного гена (рисунки 2D, F).

РИСУНОК 1. (A) Схематическое изображение локуса глицинового рибопереключателя.Аптамеры глицинового рибопереключателя 1 и 2 обозначены прямоугольниками I и II; гены изображены серыми стрелками, указывающими в направлении транскрипции; терминаторы 1225 и 1227, как предсказано TransTermHP (Kingsford et al., 2007), изображены как структуры стебель-петля, а транскрипты, обнаруженные с помощью Нозерн-блоттинга (Рисунок 4), изображены как черные линии. (B) Схематическое изображение слитых конструкций рибосвитч- luc2 : pFW11_ glyluc 2 состоит из геномного фрагмента 889 п.н., содержащего предсказанную последовательность рибосвитча глицина и его 5′-фланкирующую геномную область, включая промоторную область, слитую с luc2 .Промотор pFW11_ ribogly luc 2 состоит из фрагмента длиной 588 п.н., включающего промоторную область 5 ‘ ribogly , непосредственно слитую с luc2 .

РИСУНОК 2. Экспрессия репортерного гена LUC подавляется при высоких концентрациях глицина. (A) Рост штамма GAS M49 591 / pFW11_ glyluc 2 в CDM без глицина или с добавлением различных концентраций (0,01–10 мМ) глицина, n = 5. (B) Активность люциферазы с течением времени в GAS M49 штамм 591 / pFW11_ glyluc 2 во время роста без глицина или в присутствии различных концентраций глицина, как указано, n = 5.Статистическая значимость была определена между 0,1 и 1 мМ образцами глицина с использованием двустороннего теста ANOVA (множественные сравнения). Различия между образцами выражались в виде «нс»: не значимо, P ≥ 0,05; P <0,05; ∗∗ P <0,01; ∗∗∗ P <0,001; ∗∗∗∗ P <0,0001. (C) Рост штамма GAS M49 591 / pFW11_ glyluc 2 в CDM без серина или с добавками в различных концентрациях (0.01–10 мМ) серина, n = 3. (D) Активность люциферазы во времени в штамме GAS M49 591 / pFW11_ glyluc 2 во время роста без серина или в присутствии различных концентраций серина, как указано , n = 3. (E) Рост штамма GAS M49 591 / pFW11_ glyluc 2 в CDM без аланина или с добавлением различных концентраций (0,01-10 мМ) аланина, n = 3. ( F) Люциферазная активность во времени в штамме GAS M49 591 / pFW11_ glyluc 2 во время роста без аланина или в присутствии различных концентраций аланина, как указано, n = 3.Данные представлены в виде средних значений ± стандартное отклонение.

Предполагаемый рибопереключатель глицина контролирует экспрессию гена SAF и гена предполагаемой системы оттока катионов

Чтобы ответить на вопрос, контролирует ли предполагаемый глициновый рибопереключатель экспрессию его нижележащих генов, были проведены эксперименты с RT-qPCR. Бактерии WT выращивали в CDM, содержащем 0,1, 2,6 и 10 мМ глицина. Тотальную РНК выделяли, подвергали обратной транскрипции и амплифицировали с использованием праймеров, специфичных для предполагаемого рибопереключателя глицина ( ribogly ), гена SAF ( Na + / Ala symp ) и гена предполагаемой системы оттока катионов (отток катионов ). ) соответственно (рис. 3А).Обилие транскриптов при 0,1 мМ глицине служило калибратором для всех трех реакций. Изобилие РНК рибопереключателя не изменялось при всех испытанных концентрациях глицина. Напротив, мРНК гена SAF и системы оттока катионов резко снизилась при 2,6 и 10 мМ глицине по сравнению с 0,1 мМ глицином.

РИСУНОК 3. Экспрессия гена гена SAF и системы оттока катионов подавляется в присутствии высоких концентраций глицина. (A) Относительная экспрессия гена SAF ( Na + / Ala symp ) и гена системы оттока катионов ( отток катионов, ) по сравнению с обилием транскриптов глицинового рибопереключателя ( ribogly, ).Штамм 591 GAS M49 выращивали 3 часа в присутствии различных концентраций глицина, как указано, n = 3. (B) Промоторная область не опосредует глицин-зависимую индукцию экспрессии luc2 . GAS M49 штамм 591 / pFW11_ промотор ribogly luc 2 выращивали 3 часа в присутствии различных концентраций глицина, как указано, n = 3. Относительные данные экспрессии представлены в виде средних значений ± стандартное отклонение. Статистическая значимость определялась с использованием теста Стьюдента t .Различия между образцами выражались в виде «нс»: не значимо, P ≥ 0,05 и ∗∗∗∗ P <0,0001.

Контроль глицин-зависимых генов не основан на изменениях активности промотора

Для исследования регулирующего влияния промоторной области фрагмент длиной 588 п.н., несущий промоторную область 5 ‘ ribogly , был слит с luc (рис. 1В). Штамм 591 GAS M49 был трансформирован промотором pFW11_ ribogly luc 2.Обилие транскриптов luc2 определяли с помощью RT-qPCR после роста в присутствии 0,1, 2,6 и 10 мМ глицина. Уровень транскрипта при 0,1 мМ глицине служил калибратором. На экспрессию luc2 не влияла концентрация глицина в среде (рис. 3В).

Размеры транскриптов

зависят от концентрации глицина в среде

Экспрессия как гена SAF, так и гена системы оттока катионов подавлялась в присутствии высоких концентраций глицина (рис. 3).Были разработаны праймеры для амплификации соединений генов и использованы в экспериментах с обратной транскриптазой с последующей ПЦР. Обнаружение продукта ПЦР предполагает совместную транскрипцию двух генов. Чтобы проверить этот результат, был проведен Нозерн-блоттинг. Бактерии WT выращивали в CDM, содержащем 0,1, 2,6 или 10 мМ глицина соответственно. Тотальную РНК выделяли из культур и разделяли электрофорезом в агарозном геле. Блоты последовательно гибридизовали с РНК-зондами, специфичными для ribogly и транскрипта гена SAF ( Na + / Ala symp ).В присутствии высоких концентраций глицина (2,6 и 10 мМ) зонд ribogly обнаружил очень многочисленную полосу в 200 п.н., которая может представлять собой терминацию транскрипции или продукт расщепления РНК (рис. 4). Транскрипт гена SAF обнаружить не удалось (рис. 4). В соответствии с результатами анализа репортерного гена luc и RT-qPCR экспрессия гена подавлялась в этих условиях. В присутствии 0,1 мМ глицина полосу в 3 т.п.н. можно было обнаружить с помощью зондов ribogly и Na + / Ala symp .Кажущийся размер полосы соответствует расчетному размеру котранскрипта гена SAF и гена системы оттока катионов (3113 п.н., рис. 1). Вторую полосу с кажущимся размером 600 п.н. можно было обнаружить с помощью обоих зондов. Это соответствует продукту терминации внутри гена SAF на предполагаемом терминаторе TERM 125 (TransTermHP v2.07) (Kingsford et al., 2007). Полосу 300 п.н. детектировали с использованием зонда ribogly , но не после гибридизации с зондом Na + / Ala symp .Транскрипты, обнаруженные с помощью Нозерн-блоттинга, схематически изображены по отношению к соответствующим генам (Рисунок 1).

РИСУНОК 4. Анализ Нозерн-блоттинга . РНК экстрагировали из бактерий, выращенных в 0,1, 2,6 и 10 мМ глицине, как указано. РНК разделяли электрофорезом в денатурирующем агарозном геле и затем наносили на нейлоновую мембрану. Мембрану гибридизовали с зондами, специфичными для глицинового рибопереключателя ( ribogly, ), отделяли и гибридизовали с зондом, специфичным для гена SAF (Na + / Ala symp).Гель, окрашенный бромидом этидия, служил в качестве контроля загрузки.

Стабильность транскрипта гена

SAF снижается при высоких концентрациях глицина в среде

Транскрипты генов, контролируемых рибопереключателями, часто процессируются или демонстрируют дифференциальную стабильность (Mellin and Cossart, 2015). Мы стремились исследовать стабильность транскриптов гена ribogly, и SAF в репрессирующих и не репрессирующих условиях. Штамм 591 WT GAS M49 выращивали в присутствии 0,1 или 10 мМ глицина соответственно.Транскрипцию останавливали добавлением рифампицина, и образцы собирали для анализов RT-qPCR через 1, 2, 5 и 10 мин после обработки рифампицином (фигура 5). 5S рРНК и groES мРНК служили контролем. 5S рРНК была стабильной в течение всего периода наблюдения. Время полужизни мРНК groES было сходным при росте в 0,1 мМ глицине (1,8 мин) и 10 мМ глицине (1,9 мин). Стабильность ribogly была низкой в ​​обоих условиях. Его период полураспада составлял 0,4 мин в 0,1 и 10 мМ глицине.Напротив, стабильность Na + / Ala symp была низкой во время роста в 10 мМ глицине (0,5 мин), но намного выше в 0,1 мМ глицине (5 мин), что указывает на дополнительный уровень регуляции, зависящий от рибонуклеазы.

РИСУНОК 5. Стабильность транскрипта в условиях низкого (0,1 мМ) и высокого (10 мМ) глицина. Стабильность рибопереключателя глицина ( ribogly ) и гена SAF ( Na + / Ala symp ), определенная с помощью RT-qPCR после обработки культуры рифампицином, n = 3.5S рРНК и groES мРНК служили контролем. Стабильность представлена ​​в виде процента уровня транскрипции относительно нулевого момента времени. (A) 5S рРНК и groES стабильность мРНК при 0,1 мМ глицине. (B) ribogly и Na + / Ala symp стабильность мРНК при 0,1 мМ глицине. (C) 5S рРНК и groES стабильность мРНК при 10 мМ глицине. (D) ribogly и Na + / Ala symp стабильность мРНК при 10 мМ глицине.Данные представлены в виде средних значений ± стандартное отклонение.

ribogly Принадлежит тандемному аптамеру Glycine Riboswitches

В эталонном геноме S. pyogenes NZ131 (номер доступа: NC_011375.1) аннотирован предполагаемый глициновый рибопереключатель длиной 90 п.н. Поиск с использованием базы данных rfam (Nawrocki et al., 2015) предсказал наличие одного глицин-связывающего аптамера. Поскольку мы наблюдали полосу примерно 200 п.н. в Нозерн-блоттинге общей РНК из штамма 591 GAS M49 (рис. 4), мы выполнили предсказание вторичной структуры с помощью RNAfold (веб-службы ViennaRNA).Моделирование вторичной структуры было основано на 182 п.н. эталонного генома S. pyogenes NZ131. Результат показан на рисунке 6 с использованием графического интерфейса пользователя VARNA (Дарти и др., 2009). Анализ выявил типичную консенсусную структуру тандемного рибопереключателя аптамера, содержащего два сайта связывания глицина (Esquiaqui et al., 2014; Ruff et al., 2016). Консервативные остатки отмечены зеленым.

РИСУНОК 6. Вторичная структура рибопереключателя глицина в Streptococcus pyogenes .Вторичная структура была предсказана с помощью RNAfold и проиллюстрирована с помощью VARNA GUI (Darty et al., 2009). Консервативные остатки выделены зеленым цветом (Ruff et al., 2016). Сайты связывания глицина обозначены серыми кружками. P1, мотив Kink-turn и P0 выделены после наблюдений с глициновым рибопереключателем в Vibrio cholerae (Esquiaqui et al., 2014).

Обсуждение

Рибопереключатели часто регулируют экспрессию генов, участвующих в метаболизме или транспорте их лигандов.Обычно глициновые рибопереключатели индуцируют экспрессию генов, ответственных за расщепление или экспорт глицина после связывания глицина (Barrick et al., 2004). В Bacillus subtilis глициновый рибопереключатель состоит из двух сходных аптамеров, за которыми следует единственная платформа экспрессии (Mandal et al., 2004). В S. pyogenes один аптамер, аналогичный аптамеру B. subtilis , был предсказан выше предполагаемого гена SAF. Ранее мы наблюдали экспрессию области рибопереключателя в штамме 591 GAS M49 с помощью межгенных мозаичных массивов (Patenge et al., 2012). В клиническом изоляте SF370 экспрессия предполагаемого стрептококкового рибопереключателя была обнаружена с помощью Нозерн-блоттинга (Le Rhun et al., 2015). В этой работе мы исследовали, опосредует ли предполагаемый глициновый рибопереключатель глицин-зависимую регуляцию генов.

Анализы

репортерного гена LUC и нозерн-блоттинг показали, что экспрессия гена SAF подавлялась в присутствии глицина. Соответствующая область промотора не опосредует глицин-зависимое подавление активности luc в конструкции слияния промотор-репортерный ген.Как правило, аминокислотные рибопереключатели повышают экспрессию генов системы расщепления глицина или генов экспортного белка глицина при связывании с глицином (Serganov, Patel, 2009; Serganov, Nudler, 2013). В Streptomyces griseus система детоксикации активируется глициновым рибопереключателем (Tezuka and Ohnishi, 2014). Напротив, lysC в B. subtilis репрессируется лизин-чувствительным рибопереключателем из-за терминации транскрипции в присутствии высокой концентрации L -лизина (Phan and Schumann, 2009).Ген lysC из B. subtilis состоит из двух перекрывающихся рамок считывания, кодирующих α- и β-субъединицы лизин-чувствительной аспартокиназы II, которая катализирует первую стадию биосинтеза метионина, лизина и треонина ( Чен и др., 1987). Ген SAF в S. pyogenes кодирует члена семейства аланин или глицин: катионный симпортер (AGCS) [база данных классификации транспортеров (TCDB)] (Saier et al., 2016). Сообщалось, что белки, принадлежащие к семейству AGCS, транспортируют аланин и / или глицин в симпорте с Na + и / или H + .Ген dagA морской бактерии Alteromonas haloplanktis является натрий-зависимым переносчиком и участвует в поглощении глицина и глутамина (MacLeod and MacLeod, 1992). Мы предполагаем, что связывание глицина рибопереключателем в S. pyogenes ведет к подавлению пока неустановленной системы захвата глицина.

Усеченная форма РНК B. subtilis рибопереключателя, контролирующая lysC , преимущественно продуцируется даже в условиях, способствующих анти-терминации (Phan and Schumann, 2009).Напротив, мы обнаружили только небольшие количества усеченной РНК рибопереключателя длиной 200 п.н. в индуцирующих условиях. Стабильность РНК рибопереключателя была низкой при всех испытанных концентрациях глицина. Период полужизни полноразмерного транскрипта уменьшался при высоких концентрациях глицина. Недавно сообщалось о комбинации классической функции рибопереключателя и контроля стабильности мРНК. В E. coli экспрессия lysC контролируется на уровне инициации трансляции лизиновым рибопереключателем. После связывания лизина рибопереключатель принимает конформацию, которая изолирует сайт связывания рибосомы и в то же время открывает сайты расщепления РНКазойE (Caron et al., 2012). РНКаза E является компонентом деградосомы РНК у грамотрицательных бактерий (Callaghan et al., 2004). У большинства грамположительных организмов РНКазаE заменяется другими рибонуклеазами, например, РНКазой Y и РНКазами J1 и J2 (Cho, 2017). В S. pyogenes РНКаза Y участвует в обороте мРНК (Chen et al., 2013). Структурное исследование рибозима GlmS из B. anthracis выявило автокаталитическое расщепление мРНК GlmS в единственном сайте 5 ‘последовательности рибопереключателя после связывания глюкозамин-6-фосфата (GlcN6P).Специфическое расщепление делает мРНК GlmS чувствительной к деградации с помощью РНКазы J (Cochrane et al., 2007). Возникает соблазн предположить, что обработка транскрипта, контролируемого глициновым рибопереключателем, в S. pyogenes приводит к обнажению сайтов расщепления РНКазой и тем самым к снижению стабильности транскрипта гена SAF.

Рибопереключатель глицина — единственный рибопереключатель, который демонстрирует тандемную архитектуру, с двумя соседними гомологичными аптамерами, за которыми следует единственная платформа экспрессии. В г.subtilis , связывание глицина с помощью аптамеров рибопереключателя, как первоначально сообщалось, функционирует кооперативным образом (Mandal et al., 2004). Однако полноразмерное производное рибопереключателя, содержащее его удлиненный 5′-лидер, не обнаруживает кооперативного связывания (Sherman et al., 2012). Тандемный глициновый рибопереключатель из Vibrio cholerae , включая лидерную последовательность, изучали с использованием анализа на основе равновесного диализа. Результаты показали, что связывание лиганда аптамером-1 связано с димеризацией аптамера и стабилизирует основу P1 аптамера-2, которая контролирует платформу экспрессии (Ruff and Strobel, 2014).В недавнем исследовании анализ секвенированных геномов выявил значительное количество синглетных глициновых рибопереключателей. Некоторые синглетные рибопереключатели были охарактеризованы биохимически, и можно было продемонстрировать, что синглетные рибопереключатели были способны связывать глицин со сродством, сравнимым с аффинностью ранее опубликованных тандемных глициновых рибопереключателей. Консервативные структуры стебель-петля (аптамеры-призраки), расположенные выше или ниже синглетного аптамера, соответственно, образуют взаимодействия с доменом аптамера, которые необходимы для активности связывания лиганда (Ruff et al., 2016). В S. pyogenes один аптамер был аннотирован перед геном SAF. Второй аптамер, содержащий стебель P4, был обнаружен с помощью in silico предсказаний вторичной структуры . Последовательность непосредственно перед первым аптамером подобна консервативной лидерной области, которая взаимодействует с недавно обнаруженным линкером K-поворота тандемных глициновых рибопереключателей и модулирует связывание лиганда (Kladwang et al., 2012; Sherman et al., 2012; Baird и Ferre-D’Amare, 2013; Esquiaqui et al., 2016). Это указывает на то, что глициновый рибопереключатель S. pyogenes принадлежит к классу тандемных рибопереключателей, содержащих недавно идентифицированный линкер K-поворота.

Индуцибельные системы экспрессии — полезные инструменты в молекулярной биологии. Характеристика основных генов и производство потенциально токсичных генных продуктов — это лишь два из многих примеров требования условного контроля экспрессии генов. Системы на основе Riboswitch для точной регуляции генов имеют то преимущество, что экспрессию можно контролировать путем добавления небольших соединений, которые легко проникают в клетку и во многих случаях являются сравнительно недорогими (Machtel et al., 2016). Система экспрессии, индуцируемая глицином, была разработана с использованием рибопереключателя из B. subtilis . Авторы смогли продемонстрировать глицин-зависимое производство рекомбинантных белков (Phan and Schumann, 2007). С помощью сопоставимой стратегии можно создать систему нокаута или нокаута гена с использованием глицинового рибопереключателя S. pyogenes .

Рибопереключатели являются потенциальными мишенями для антимикробной терапии (Machtel et al., 2016). К широко изученным мишеням относятся пуриновые рибопереключатели.Пурины необходимы для выживания бактерий, а пуриновые рибопереключатели контролируют метаболизм и транспорт пуринов (Lunse et al., 2014). Продолжается поиск подходящих аналогов пурина, которые связывают рибопереключатель со сродством, сопоставимым с гуанозином (Kim et al., 2009; Mulhbacher et al., 2010). Помимо основных путей, контроль образования биопленок с помощью рибопереключателей является многообещающей мишенью для противомикробных препаратов (Reyes-Darias and Krell, 2017). Рибопереключатели лизина также исследовались как потенциальные мишени, и было идентифицировано несколько аналогов лизина с высоким сродством связывания, но возникли трудности, связанные с токсичностью соединений и устойчивостью бактерий (Blount et al., 2007). Глицин необходим для оптимального роста S. pyogenes . Глициновый рибопереключатель S. pyogenes высоко консервативен среди различных серотипов. Идентичность последовательностей рибопереключателя в завершенных геномных последовательностях S. pyogenes составляет 99–100%. Подавление транспорта глицина стрептококками путем нацеливания на рибопереключатель глицина с помощью аналога глицина может служить новой терапевтической стратегией. Альтернативно, лиганды для еще не охарактеризованных рибопереключателей в S.pyogenes следует идентифицировать и исследовать на предмет их целевого лекарственного потенциала.

Авторские взносы

АК и НИП провели эксперименты, представленные в рукописи. AK, NIP, BK и NAP внесли свой вклад в разработку этого исследования, анализ и интерпретацию данных, составление рукописи и одобрили ее для публикации.

Финансирование

Наша работа была поддержана грантами от Bundesministerium für Bildung und Forschung (FKZ 0315437B) и от Ministerium für Bildung, Wissenschaft und Kultur, Мекленбург-Передняя Померания (ESF / 14-BM-A55-0010 / 16) и University Medicine Росток (Форум 889008).

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fmicb.2018.00200/full#supplementary-material

Сноски

  1. http: // rna.tbi.univie.ac.at/

Список литературы

Бэрд, Н. Дж., И Ферре-Д’Амар, А. Р. (2013). Модуляция четвертичной структуры и усиление связывания лиганда за счет K-поворота тандемных глициновых рибопереключателей. РНК 19, 167–176. DOI: 10.1261 / rna.036269.112

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Баррик Дж. Э., Корбино К. А., Винклер В. К., Нахви А., Мандал М., Коллинз Дж. И др. (2004). Новые мотивы РНК предполагают расширение возможностей рибопереключателей в генетическом контроле бактерий. Proc. Natl. Акад. Sci. США 101, 6421–6426. DOI: 10.1073 / pnas.0308014101

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Блаунт, К. Ф., Ван, Дж. Х., Лим, Дж., Сударсан, Н., и Брейкер, Р. Р. (2007). Антибактериальные аналоги лизина, нацеленные на лизиновые рибопереключатели. Nat. Chem. Биол. 3, 44–49. DOI: 10.1038 / nchembio842

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Каллаган, А. Дж., Аурикко, Дж. П., Илаг, Л.L., Gunter, G.J., Chandran, V., Kuhnel, K., et al. (2004). Исследования домена, организующего деградосомы РНК Escherichia coli, РНКазы E. J. Mol. Биол. 340, 965–979. DOI: 10.1016 / j.jmb.2004.05.046

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Карон, М. П., Бастет, Л., Люсье, А., Симоно-Рой, М., Масс, Э. и Лафонтен, Д. А. (2012). Рибопереключатель двойного действия, контролирующий инициацию трансляции и распад мРНК. Proc.Natl. Акад. Sci. США 109, E3444 – E3453. DOI: 10.1073 / pnas.1214024109

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чен Н. Ю., Ху Ф. М. и Паулюс Х. (1987). Нуклеотидная последовательность перекрывающихся генов субъединиц Bacillus subtilis аспартокиназы II и их контрольных областей. J. Biol. Chem. 262, 8787–8798.

PubMed Аннотация | Google Scholar

Чен, З., Ицек, А., Малке, Х., Ферретти, Дж.Дж. И Крет Дж. (2013). Множественные роли РНКазы Y в процессинге и деградации мРНК Streptococcus pyogenes . J. Bacteriol. 195, 2585–2594. DOI: 10.1128 / JB.00097-13

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чо, К. Х. (2017). Структура и функция деградосомы грамположительной бактериальной РНК. Фронт. Microbiol. 8: 154. DOI: 10.3389 / fmicb.2017.00154

CrossRef Полный текст | Google Scholar

Кокрейн, Дж.К., Липхок, С. В., и Штробель, С. А. (2007). Структурное исследование рибозима GlmS, связанного с его каталитическим кофактором. Chem. Биол. 14, 97–105. DOI: 10.1016 / j.chembiol.2006.12.005

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Данн, К. Э. III, Уэйкман, К. А., Силинг, К. Л., Бейкер, С. К., Ирнов, И., и Винклер, В. К. (2007). Структура и механизм металл-чувствительной регуляторной РНК. Ячейка 130, 878–892. DOI: 10.1016 / j.cell.2007.06.051

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дарти К., Дениз А. и Понти Ю. (2009). ВАРНА: Интерактивное рисование и редактирование вторичной структуры РНК. Биоинформатика 25, 1974–1975. DOI: 10.1093 / биоинформатика / btp250

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эскиаки, Дж. М., Шерман, Э. М., Ионеску, С. А., Йе, Дж. Д. и Фануччи, Г. Э. (2014). Характеристика динамики взаимодействия лидер-линкер в глициновом рибопереключателе с помощью сайт-направленного спинового мечения. Биохимия 53, 3526–3528. DOI: 10.1021 / bi500404b

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эскиаки, Дж. М., Шерман, Э. М., Йе, Дж. Д., и Фануччи, Г. Э. (2016). Конформационная гибкость и динамика внутренней петли и спиральных областей мотива изгиба-поворота в глициновом рибопереключателе посредством сайт-направленного спин-мечения. Биохимия 55, 4295–4305. DOI: 10.1021 / acs.biochem.6b00287

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гранди, Ф.Дж., Леман, С. К., и Хенкин, Т. М. (2003). L-бокс регулон: восприятие лизина лидерными РНК генов бактериального биосинтеза лизина. Proc. Natl. Акад. Sci. США 100, 12057–12062. DOI: 10.1073 / pnas.2133705100

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ким, Дж. Н., Блаунт, К. Ф., Пускарц, И., Лим, Дж., Линк, К. Х. и Брейкер, Р. Р. (2009). Дизайн и антимикробное действие аналогов пурина, связывающих рибопереключатели гуанина. ACS Chem. Биол. 4, 915–927. DOI: 10.1021 / cb6k

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кингсфорд, К. Л., Аянбуле, К., и Зальцберг, С. Л. (2007). Быстрое, точное, компьютерное открытие Rho-независимых терминаторов транскрипции проливает свет на их связь с захватом ДНК. Genome Biol. 8: R22. DOI: 10.1186 / GB-2007-8-2-r22

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кладванг В., Чжоу Ф. К. и Дас Р.(2012). Автоматическое предсказание структуры РНК обнаруживает линкер изгиба поворота в двойных глициновых рибопереключателях. J. Am. Chem. Soc. 134, 1404–1407. DOI: 10.1021 / ja2093508

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ле Рун, А., Бир, Ю. Ю., Реймегард, Дж., Чилински, К., и Шарпантье, Э. (2015). Секвенирование РНК раскрывает антисмысловые РНК и новые малые РНК в Streptococcus pyogenes . RNA Biol. 13, 177–195. DOI: 10.1080 / 15476286.2015.1110674

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Levering, J., Fiedler, T., Sieg, A., van Grinsven, K. W., Hering, S., Veith, N., et al. (2016). Реконструкция в масштабе генома метаболической сети Streptococcus pyogenes M49 выявляет потребности роста и указывает на потенциальные мишени для лекарств. J. Biotechnol. 232, 25–37. DOI: 10.1016 / j.jbiotec.2016.01.035

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лунсе, К.Э., Шуллер А., Майер Г. (2014). Перспективы рибопереключателей в качестве потенциальных мишеней для антибактериальных препаратов. Внутр. J. Med. Microbiol. 304, 79–92. DOI: 10.1016 / j.ijmm.2013.09.002

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Machtel, P., Bakowska-Zywicka, K., and Zywicki, M. (2016). Новые области применения рибопереключателей — от антибактериальных мишеней до молекулярных инструментов. J. Appl. Genet. 57, 531–541. DOI: 10.1007 / s13353-016-0341-x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

MacLeod, P.Р., и МакЛауд, Р. А. (1992). Идентификация и последовательность Na (+) — связанного гена морской бактерии Alteromonas haloplanktis , который функционально дополняет ген dagA Escherichia coli . Мол. Microbiol. 6, 2673–2681. DOI: 10.1111 / j.1365-2958.1992.tb01444.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Мандал, М., Ли, М., Баррик, Дж. Э., Вайнберг, З., Эмильссон, Г. М., Руццо, В. Л. и др. (2004).Глицин-зависимый рибопереключатель, который использует кооперативное связывание для контроля экспрессии генов. Наука 306, 275–279. DOI: 10.1126 / science.1100829

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Mulhbacher, J., Brouillette, E., Allard, M., Fortier, L.C., Malouin, F., and Lafontaine, D.A. (2010). Новые аналоги лиганда рибопереключателя в качестве селективных ингибиторов метаболических путей, связанных с гуанином. PLoS Pathog. 6: e1000865. DOI: 10.1371 / journal.ppat.1000865

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Nawrocki, E. P., Burge, S. W., Bateman, A., Daub, J., Eberhardt, R. Y., Eddy, S. R., et al. (2015). Rfam 12.0: обновления базы данных семейств РНК. Nucleic Acids Res. 43, D130 – D137. DOI: 10.1093 / nar / gku1063

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Патенж, Н., Миллион, А., Рааш, П., Норманн, Дж., Вишневска-Кучпер, А., Рети, Дж. И др. (2012). Идентификация новых зависимых от фазы роста и среды малых некодирующих РНК в Streptococcus pyogenes M49 с использованием межгенных тайлинговых массивов. BMC Genomics 13: 550. DOI: 10.1186 / 1471-2164-13-550

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фан, Т. Т., и Шуман, В. (2009). Транскрипционный анализ лизин-чувствительного и регулируемого рибосвитчем гена lysC Bacillus subtilis . Curr. Microbiol. 59, 463–468. DOI: 10.1007 / s00284-009-9461-4

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Подбельский, А., Войшник, М., Леонард, Б.А., и Шмидт, К.Х. (1999). Характеристика nra , гена глобального негативного регулятора стрептококков группы А. Мол. Microbiol. 31, 1051–1064. DOI: 10.1046 / j.1365-2958.1999.01241.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Рейес-Дариас, Дж. А., и Крелл, Т. (2017). Рибопереключатели как потенциальные мишени для разработки препаратов против биопленки. Curr. Вершина. Med. Chem. DOI: 10.2174 / 1568026617666170407163517 [Epub перед печатью].

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Родионов Д.А., Витрещак А.Г., Миронов А.А., Гельфанд М.С. (2003). Регуляция биосинтеза лизина и транспортных генов у бактерий: еще один рибопереключатель РНК? Nucleic Acids Res. 31, 6748–6757.

PubMed Аннотация | Google Scholar

Рафф К. М., Мухаммад А., МакКаун П. Дж., Брейкер Р. Р. и Штробель С. А. (2016). Синглетные глициновые рибопереключатели связывают лиганд, а также тандемные рибопереключатели. РНК 22, 1728–1738. DOI: 10.1261 / rna.057935.116

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Руфф К. М., Стробель С. А. (2014). Связывание лиганда тандемным глициновым рибопереключателем зависит от димеризации аптамера, но не от занятости двойного лиганда. РНК 20, 1775–1788. DOI: 10.1261 / rna.047266.114

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сайер, М. Х. младший, Редди, В. С., Цу, Б. В., Ахмед, М. С., Ли, К., и Морено-Хагельсиб, Г. (2016). База данных классификации транспортеров (TCDB): последние достижения. Nucleic Acids Res. 44, D372 – D379. DOI: 10.1093 / nar / gkv1103

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Шерман, Э. М., Эскиаки, Дж., Эльсайед, Г., и Йе, Дж. Д. (2012). Энергетически выгодное взаимодействие лидер-линкер устраняет кооперативность связывания лиганда в глициновых рибопереключателях. РНК 18, 496–507. DOI: 10.1261 / rna.031286.111

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Симс, С.А., Колкухун, С., Вайбер, Р., Карапетис, Дж. Р. (2016). «Глобальное бремя болезней группы A Streptococcus » в Streptococcus Pyogenes: от базовой биологии до клинических проявлений , ред. Дж. Дж. Ферретти, Д. Л. Стивенс и В. А. Фишетти (Оклахома-Сити, Оклахома: Центр медицинских наук Университета Оклахомы).

Google Scholar

Сударсан Н., Ли, Э. Р., Вайнберг, З., Мой, Р. Х., Ким, Дж. Н., Линк, К. Х. и др. (2008). Рибопереключатели у эубактерий ощущают вторичный мессенджер циклический ди-GMP. Наука 321, 411–413. DOI: 10.1126 / science.1159519

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сударсан, Н., Викизер, Дж. К., Накамура, С., Эберт, М. С., и Брейкер, Р. Р. (2003). Структура мРНК в бактериях, которая контролирует экспрессию генов путем связывания лизина. Genes Dev. 17, 2688–2697. DOI: 10.1101 / gad.1140003

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Тэдзука, Т., и Охниши, Ю. (2014). Два глициновых рибопереключателя активируют систему расщепления глицина, необходимую для детоксикации глицина у Streptomyces griseus . J. Bacteriol. 196, 1369–1376. DOI: 10.1128 / JB.01480-13

PubMed Аннотация | CrossRef Полный текст | Google Scholar

ван де Рейн, И., и Кесслер, Р. Э. (1980). Характеристики роста стрептококков группы А в новой среде с определенным химическим составом. Заражение. Иммун. 27, 444–448.

PubMed Аннотация | Google Scholar

Винклер В., Нахви А. и Брейкер Р. Р. (2002). Производные тиамина напрямую связывают информационные РНК, регулируя экспрессию бактериальных генов. Природа 419, 952–956. DOI: 10.1038 / nature01145

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Винклер В. К., Коэн-Чаламиш С. и Брейкер Р. Р. (2002). Структура мРНК, которая контролирует экспрессию гена путем связывания FMN. Proc. Natl. Акад. Sci. США 99, 15908–15913. DOI: 10.1073 / pnas.212628899

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Винклер, В. К., Нахви, А., Сударсан, Н., Баррик, Дж. Э.и Брейкер Р. Р. (2003). Структура мРНК, которая контролирует экспрессию гена путем связывания S-аденозилметионина. Nat. Struct. Биол. 10, 701–707. DOI: 10.1038 / nsb967

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Янофский, К. (1981). Ослабление контроля экспрессии бактериальных оперонов. Природа 289, 751–758. DOI: 10.1038 / 289751a0

CrossRef Полный текст | Google Scholar

Внеклеточный серин и глицин необходимы для функционирования стволовых клеток и клеток-предшественников скелетных мышц мыши и человека.

Основные моменты

Внеклеточные серин и глицин необходимы для увеличения популяции мышечных стволовых / клеток-предшественников.

Клетки-предшественники мышц человека обладают ограниченной способностью к de novo биосинтезу серина / глицина.

Ограничение внеклеточного серина / глицина увеличивает количество активных форм кислорода и снижает внутриклеточный глутатион.

Внеклеточный серин / глицин подавляет синтез белка и остановку клеточного цикла.

Снижение уровня внеклеточного серина и глицина у старых мышей нарушает регенерацию скелетных мышц.

Реферат

Цель

Регенерация скелетных мышц зависит от мышечно-специфических взрослых стволовых клеток (MuSC), потомства MuSC, клеток-предшественников мышц (MPC) и скоординированной миогенной программы, на которую влияет внеклеточная среда. После травмы MPCs проходят кратковременный и быстрый период роста популяции, который необходим для восстановления поврежденных миофибрилл и восстановления гомеостаза мышц. Определенные патологии (например, метаболические заболевания и мышечные дистрофии) и пожилой возраст связаны с нарушением регуляции регенерации мышц.Доступность серина и глицина, двух незаменимых в питательном отношении аминокислот, изменяется у людей с этими патологиями, и было показано, что эти аминокислоты влияют на пролиферативное состояние немышечных клеток. Наша цель состояла в том, чтобы определить роль серина / глицина в функции MuSC / MPC.

Методы

Первичные ПДК человека ( ч, ПДК) были использованы для экспериментов in vitro, и молодых (4–6 месяцев) и старых (> 20 месяцев) мышей использовали для экспериментов in vivo, .Доступность серина / глицина регулировали с помощью специально разработанной среды in vitro или диетического ограничения in vivo с последующим анализом метаболизма и пролиферации клеток.

Результаты

Мы определили, что серин / глицин необходимы для пролиферации ч ПДК. Диетическое ограничение серина / глицина на мышиной модели регенерации скелетных мышц снизило количество MuSC через 3 дня после травмы. Исследования по отслеживанию стабильных изотопов показали, что ч ПДК зависят от внеклеточного серина / глицина для увеличения популяции, поскольку они демонстрируют ограниченную способность к биосинтезу серина / глицина de novo .Ограничение серина / глицина до ч MPC привело к остановке клеточного цикла в G0 / G1. Внеклеточный серин / глицин был необходим для поддержки глутатиона и глобального синтеза белка в ч ПДК. Используя модель старых мышей, мы обнаружили, что снижение доступности серина / глицина увеличивает межмиоцеллюлярные адипоциты через 28 дней после травмы.

Выводы

Эти исследования продемонстрировали, что, несмотря на абсолютную потребность в серине / глицине для пролиферации MuSC / MPC, синтез de novo был недостаточен для поддержки этих требований, что делало внеклеточный серин и глицин условно необходимыми для эффективной регенерации скелетных мышц.

Ключевые слова

Мышцы

Регенерация мышц

Мышечные стволовые клетки

Мышечные клетки-предшественники

Пролиферация

Мышечный метаболизм

Метаболизм серина

Статьи о метаболизме глицина

Синтез белков

© 2020 Авторы. Опубликовано Elsevier GmbH.

Рекомендуемые статьи

Цитирующие статьи

Аутокринная обратная связь глицин-инсулин усиливает секрецию инсулина из человеческих β-клеток и нарушается при диабете 2 типа

Резюме

Секреция инсулина β-клетками панкреатических островков имеет решающее значение для гомеостаз глюкозы.Нарушение секреции инсулина лежит в основе почти всех форм диабета, включая наиболее частую форму — диабет 2 типа (T2D). Контроль секреции инсулина сложен и зависит от циркулирующих питательных веществ, нервных импульсов и локальной передачи сигналов. В текущем исследовании мы изучили вклад глицина, аминокислоты и нейромедиатора, который активирует лиганд-зависимые токи Cl , в секрецию инсулина островками людей-доноров с СД2 и без него. Мы обнаружили, что островковые β-клетки человека экспрессируют рецепторы глицина (GlyR), особенно субъединицу GlyRα1 и изоформы переносчика глицина (GlyT) GlyT1 и GlyT2.β-клетки проявляют значительные индуцированные глицином токи Cl , которые способствуют деполяризации мембраны, проникновению Ca 2+ и секреции инсулина β-клетками от доноров без T2D. Однако экспрессия GlyRα1 и токи, индуцированные глицином, снижаются в β-клетках от доноров с T2D. Глицин активно очищается GlyT, экспрессируемым в β-клетках, которые накапливают и высвобождают глицин, который действует аутокринным образом. Наконец, существует значимая положительная взаимосвязь между инсулином и GlyR, потому что инсулин усиливает ток, активируемый глицином, зависимым от фосфоинозитид-3-киназы образом, петля положительной обратной связи, которую мы обнаруживаем, полностью теряется в β-клетках от доноров с T2D.

Введение

Многие нейротрансмиттеры модулируют секрецию инсулина, изменяя электрическую активность β-клеток через ионные каналы и рецепторы (1–4). Эти сигналы могут исходить от кровообращения, нервных волокон и / или островков поджелудочной железы (5). Правильная передача сигналов нейротрансмиттера имеет решающее значение для координации секреции инсулина всеми островками поджелудочной железы, и дисфункция этой передачи сигналов может быть связана с патогенезом диабета. Множество недавних метаболических исследований, посвященных изучению биомаркеров диабета 2 типа (T2D), выявили глицин в качестве потенциального кандидата (6–16).Существует сильная корреляция между концентрацией глицина в плазме и чувствительностью к инсулину (7,13), утилизацией глюкозы (8) и ожирением (9,17). Концентрация глицина в циркулирующей плазме обратно пропорциональна риску СД2 (6–8). Кроме того, добавка глицина повышает уровень инсулина в плазме (18,19).

Глицин — это заменимая аминокислота, которая в большом количестве содержится в продуктах, богатых коллагеном. В центральной нервной системе глицин действует как тормозящий нейротрансмиттер, активируя семейство лиганд-управляемых каналов Cl , называемых рецепторами глицина (GlyR).Они принадлежат к семейству пентамерных лиганд-управляемых ионных каналов и состоят из двух α- и трех β-субъединиц (20). Помимо глицина, GlyR также активируется β-аланином и таурином, тогда как стрихнин является мощным и специфическим ингибитором (20). Концентрации внеклеточного глицина регулируются переносчиками глицина (GlyT), которые принадлежат к Na + -зависимым переносчикам растворенных веществ семейства 6 (SLC6), где переносчик глицина 1 (GlyT1) совместно транспортирует два Na + , один Cl . , и один глицин, и переносчик глицина 2 (GlyT2) совместно транспортирует три Na + , один Cl и один глицин (21).

Здесь мы исследовали роль глицина в секреции инсулина островками Лангерганса поджелудочной железы человека. Мы демонстрируем, что человеческие β-клетки экспрессируют GlyR, особенно GlyRα1, который опосредует деполяризующий ток Cl , который усиливает возбуждение потенциала действия, вход Ca 2+ и секрецию инсулина. Этот GlyR-опосредованный ток усиливается инсулином в β-клетках от доноров без T2D, но не в β-клетках от доноров с T2D, где мы обнаруживаем, что экспрессия белка GlyRα1 и токи, активируемые глицином, подавляются.Кроме того, человеческие β-клетки экспрессируют GlyT1 и GlyT2, которые опосредуют поглощение глицина, который высвобождается из β-клеток посредством Ca 2+ -зависимого экзоцитоза. Таким образом, аутокринная петля обратной связи глицин-инсулин положительно регулирует секрецию инсулина, и ее дисфункция может способствовать нарушению секреции при СД2 у человека.

Дизайн и методы исследования

Культура клеток и трансфекция

Островки от 50 человек-доноров были выделены Институтом диабета Альберты IsletCore (22) или Лабораторией клинических островков (23) в Университете Альберты при наличии соответствующего этического разрешения Совет по этике исследований человека Университета Альберты (Pro00013094; Pro 00001754).Информация о донорах описана в дополнительных таблицах 1 и 2. Островки мышей были получены от мышей-самцов C57 / Bl6 в возрасте 10–12 недель, и эксперименты были одобрены Комитетом по уходу и использованию животных Университета Альберты (AUP00000291). Островки собирали вручную и диспергировали путем инкубации в буфере, не содержащем Ca 2+ (Life Technologies), с последующим растиранием. Суспензию клеток высевали на чашки Петри или покровные стекла и культивировали в среде RPMI (Corning или Life Technologies), содержащей 7,5 ммоль / л глюкозы, в течение> 24 ч перед экспериментами.Для измерения высвобождения глицина клетки трансфицировали плазмидой, кодирующей субъединицу GlyRα1 мыши (предоставленную G.E. Yevenes и H.U. Zeilhofer, University of Zurich [24]), используя Lipofectamine 2000 (Life Technologies). Плазмида, кодирующая GFP, была включена в качестве маркера трансфекции (pAdtrackCMV).

Электрофизиология

Патч-пипетки были извлечены из класса боросиликатов и отполированы огнем (сопротивление наконечника 4–7 Мегаом для большинства экспериментов и 3–4 Мегаом для экспериментов по инфузии Ca 2+ ).Регистрацию патч-зажим выполняли в стандартных конфигурациях целых клеток или в конфигурации с перфорированным патчем с использованием усилителя EPC10 и программного обеспечения Patchmaster (HEKA Electronik). Клетки непрерывно перифузировали внеклеточным раствором (за исключением экспериментов с остановленным потоком) при температуре бани ~ 32 ° C. После экспериментов типы клеток были установлены с помощью иммуноцитохимии, как описано ранее (25). Для регистрации мембранного потенциала и тока буфер Кребса-Рингера (KRB), состоящий из (в ммоль / л) 140 NaCl, 3.6 KCl, 0,5 MgSO 4 , 1,5 CaCl 2 , 10 HEPES, 0,5 NaH 2 PO 4 , 5 NaHCO 3 и 6 глюкозы (pH доведен до 7,4 с помощью NaOH) использовали в качестве раствора для ванны. . Для измерения высвобождения глицина внеклеточная среда содержала (в ммоль / л) 118 NaCl, 20 тетраэтиламмоний-Cl, 5,6 KCl, 2,6 CaCl 2 , 1,2 MgCl 2 , 5 HEPES и 6 глюкозы (pH доведен до 7,4). с NaOH). Для экспериментов с перфорированным пластырем раствор пипетки содержал (в ммоль / л) 76 K 2 SO 4 , 10 KCl, 10 NaCl, 1 MgCl 2 , 5 HEPES и 0.24 мг / мл амфотерицина B или 50 мкг / мл грамицидина (pH доведен до 7,35 с помощью КОН). Вызванные глицином мембранные токи регистрировали с помощью внутриклеточного раствора, содержащего (в ммоль / л) 130 KCl, 1 MgCl 2 , 1 CaCl 2 , 10 EGTA, 5 HEPES и 3 MgATP (pH доведен до 7,2 с помощью КОН). . Для измерения высвобождения глицина раствор пипетки состоял (в ммоль / л) из 120 CsCl, 1 MgCl 2 , 9 CaCl 2 , 10 EGTA, 10 HEPES, 3 MgATP и 0,1 цАМФ (pH доведен до 7,2 с помощью CsOH).Во время записи клетки зажимали при -70 мВ. Для экспериментов по высвобождению глицина анализ проводили с помощью программного обеспечения Mini Analysis 6 (Synaptosoft).

Иммуногистохимия

Депарафинированные срезы ткани поджелудочной железы человека нагревали в 10 ммоль / л цитрата Na + (pH 6) в течение 15 минут с последующей 15-минутной стадией охлаждения в том же буфере. Срезы промывали PBS и блокировали 20% козьей сывороткой в ​​течение 30 мин. Антитела против субъединицы GlyRα1 (разведены 1: 100 в 5% козьей сыворотке; Synaptic Systems), субъединицы GlyRα3 (разведены 1: 100 в 5% ослиной сыворотке; Santa Cruz Biotechnology), GlyT1 (разведены 1: 100 в 5% ослиной сыворотке; Santa Cruz Biotechnology) или GlyT2 (разведенный 1: 200 в 5% козьей сыворотке; антитела Atlas) затем добавляли к срезам и инкубировали в течение ночи.Срезы промывали PBS, а затем к срезам добавляли антитела к инсулину (разведенные 1: 1000 в козьей сыворотке [Sigma-Aldrich] и разведенные 1: 100 в 5% ослиной сыворотке [Santa Cruz Biotechnology]) и инкубировали их в течение 60 минут. После стадии промывки в PBS срезы инкубировали с флуоресцентно меченными вторичными антителами Alexa Fluor 594 и 488 (разведенные 1: 200; Thermo Fisher) в течение еще 60 мин. Образцы снова промывали, инкубировали с 300 нмоль / л DAPI (Thermo Fisher) в течение 5 мин и помещали в антифад ProLong (Life Technologies).Изображения были получены с помощью инвертированного микроскопа, оснащенного системой визуализации Zeiss Colibri. Количественное отображение GlyR в островках от доноров с СД2 и без него при постоянном времени воздействия анализировали с помощью Volocity (PerkinElmer). Вычитание фона выполняли с помощью программного обеспечения ImageJ (National Institutes of Health, Bethesda, MD).

Измерения [Ca

2+ ] i

Диспергированные островковые клетки инкубировали в культуральной среде, содержащей 1 мкмоль / л Fura-2 AM (Life Technologies) в течение 10 мин.Покровные стекла помещали в инвертированный микроскоп и обрабатывали KRB, содержащим 6 ммоль / л глюкозы (если не указано иное). Флуоресценцию возбуждали при длине волны 340 и 380 нм (соотношение интенсивностей 5: 2) с использованием источника света олигохрома (TILL Photonics) и объектива × 20 (Zeiss Fluar). Эмиссию контролировали на длине волны 510 нм, а изображения регистрировали при 0,5 Гц с использованием камеры устройства с усиленной зарядовой связью и программного обеспечения Life Acquisition (TILL Photonics). Типы клеток были идентифицированы после эксперимента с помощью иммуноцитохимии, как описано ранее (25).Коэффициенты возбуждения (340/380 нм) были впоследствии рассчитаны в автономном режиме на основе захваченных изображений в интересующих областях, соответствующих идентифицированным типам клеток, с использованием программного обеспечения ImageJ.

Секреция инсулина

Секрецию инсулина измеряли с помощью статических анализов секреции, как описано ранее (26), или путем перифузии при 37 ° C в KRB с (в ммоль / л) 115 NaCl, 5 KCl, 24 NaHCO 3 , 2,5 CaCl 2 , 1 MgCl 2 , 10 HEPES и 0,1% BSA (pH 7,4 с NaOH). Для перифузии перифузировали 15 островков на полосу (0.25 мл / мин) с 1 ммоль / л глюкозы KRB (с 1 мкмоль / л стрихнина или без него) в течение 24 минут, а затем в указанных условиях. Образцы собирали через 2-минутные интервалы. Островки лизировали в кислотно-этанольном буфере (1,5% концентрированной HCl, 23,5% уксусной кислоты и 75% этанола) для определения общего содержания инсулина. Образцы анализировали с использованием набора для обнаружения инсулина (Meso Scale Discovery).

Анализ данных

Данные выражены как средние значения ± SEM, если не указано иное. Статистическую значимость оценивали с помощью теста Стьюдента t или двухфакторного дисперсионного анализа. P Значения <0,05 считались значимыми.

Результаты

Экспрессия

GlyR в островках человека от доноров с T2D и без него

Анализ

ОТ-ПЦР выявил экспрессию субъединиц GlyR α1, α3 и β в островках человека (дополнительный рисунок 1 A и B ) . Количественную иммунофлуоресценцию проводили на срезах ткани поджелудочной железы, взятых у доноров без T2D (4 донора) и от доноров с T2D (4 донора) для измерения уровней белка GlyRα1 и GlyRα3 в β-клетках.Иммуноокрашивание субъединиц GlyRα1 и GlyRα3 в срезах ткани поджелудочной железы выявило экспрессию в инсулин-положительных клетках от доноров с T2D и без них (рис. 1 и дополнительные рис. 2 и 3). Экспрессия GlyRα1 была выше у доноров без T2D (480 ± 35 средняя интенсивность пикселей [PI], 4 донора), чем у доноров с T2D (309 ± 24 средних PI, 4 донора; P <0,001) (Рис. 1 B и дополнительный рис.1 C ), тогда как экспрессия GlyRα3 оказалась ниже, чем у GlyRα1, и не различалась между донорами без T2D (304 ± 24 в среднем PI, 4 донора) и с T2D (268 ± 30 в среднем PI, 4 донора) (Рисунок.1 C и D и дополнительный рисунок 1 D ).

Рисунок 1

Экспрессия GlyR в островках человека. A : Типичные изображения экспрессии GlyRα1 в срезах ткани поджелудочной железы от доноров с T2D и без него по количественной иммунофлуоресценции (GlyRα1, красный; инсулин, зеленый; DAPI, синий). B : Среднее значение PI GlyRα1 в инсулин-положительных клетках от доноров с СД2 и без него. C : Типичные изображения экспрессии GlyRα3 в срезах ткани поджелудочной железы от доноров с T2D и без него по количественной иммунофлуоресценции (GlyRα3, красный; инсулин, зеленый; DAPI, синий). D : Среднее значение GlyRα3 PI в инсулин-положительных клетках от доноров с T2D и без. Диаграммы разброса представляют значения для отдельных островков от четырех доноров в каждой группе. *** П <0,001.

В соответствии с обнаружением субъединиц GlyR с помощью иммуноцитохимии, мы наблюдали значительные глицин-активированные токи Cl в человеческих β-клетках, которые были идентифицированы с помощью иммуноокрашивания инсулина после эксперимента (рис. 2 A и B ). ).Внеклеточное применение глицина (300 мкмоль / л) вызвало большие внутренние токи в 56 из 62 человеческих β-клеток (рис. 2 Ai ). Амплитуда тока в среднем составляла -316 пА (-26 ± 3 пА / пФ, 9 доноров) (рис.2 B ) и была активирована наполовину максимально под действием 90 мкмоль / л глицина ( n = 9 клеток, 2 донора). (Рис.2 C ). Вызванные глицином токи снижались на 92 ± 3% ( n = 7 клеток, 4 донора; P <0,001) в присутствии 1 мкмоль / л стрихнина. Вызванные глицином, чувствительные к стрихнину токи также были обнаружены в α-клетках, но токи обнаруживались реже (3 из 10 клеток), а амплитуды были намного меньше по сравнению с β-клетками (−9.3 ± 2,1 пА и -3,2 ± 0,5 пА / пФ, 3 донора) (рис.2 Aii ). В β-клетках мыши глицин вызывал чувствительный к стрихнину ток только в 3 из 15 β-клеток (-26 ± 19 пА и -4,5 ± 2 пА / пФ) (рис. 2 Aiii ), тогда как глицин не вызывал ток в β-клетках крыс ( n = 11 клеток; данные не показаны), что указывает на видоспецифические различия в токах, вызванных глицином. Наконец, ток, активированный глицином, наблюдался в 36 из 52 β-клеток от доноров с T2D и имел среднюю амплитуду -151 пА.В соответствии со сниженным иммунным окрашиванием GlyRα1 островков от доноров с T2D, мы обнаружили в β-клетках от доноров с T2D, что вызванные глицином токи значительно меньше, чем у контрольных доноров без T2D (-12 ± 2 пА / пФ, н. = 36 клеток, 5 доноров; P <0,001) (рис.2 Aiv и B ). Чувствительный к глицину ток продемонстрировал обратный потенциал, соответствующий ожидаемому от тока, опосредованного Cl , в наших растворах (13.5 мВ, n = 18 клеток, 4 донора) (рис.2 D ).

Рисунок 2

Обнаружение GlyR-опосредованных токов Cl путем фиксации фрагментами целых клеток в островковых клетках человека. A : Типичные следы, показывающие глицин (300 мкмоль / л), вызванный внутренними токами (черные следы) в β-клетках от донора без T2D ( i ), в α-клетках ( ii ), в β-клетках мыши. -клетки ( iii ) и в человеческих β-клетках от донора с T2D ( iv ). Серые следы были получены в присутствии стрихнина 1 мкмоль / л.Обратите внимание на разные масштабные линейки. B : вызванные глицином внутренние токи, нормализованные к размеру клетки. C : кривая доза-ответ вызванных глицином токов в человеческих β-клетках. Ответы были нормализованы к ответам, полученным с глицином 300 мкмоль / л. D : Вольт-амперная зависимость токов, вызванных 300 мкмоль / л глицина. *** P <0,001 по сравнению с клетками от доноров без СД2.

Затем мы исследовали влияние глицина на мембранный потенциал β-клеток человека, используя конфигурацию перфорированного пластыря.В присутствии 6 ммоль / л глюкозы внеклеточное применение глицина (100 мкмоль / л) деполяризовало клетки и увеличило потенциал действия (рис. 3). В одной серии экспериментов (рис. 3 A – C ) глицин вызывал значительно более частое срабатывание потенциала действия (2,9 ± 0,5 Гц, n = 6 клеток, 2 донора) по сравнению с контрольными клетками (0,6 ± 0,2 Гц, n = 6 клеток, 2 донора; P <0,01) (рис.3 A и B ) и уменьшенная высота потенциала действия (46 ± 3 мВ, n = 6 клеток, 2 донора) по сравнению с контрольными клетками (56 ± 3 мВ, n = 6 клеток, 2 донора; P <0.05) (Рис.3 A и C ). В отдельной серии экспериментов этот эффект был предотвращен стрихнином (рис. 3 D ). Глицин деполяризовал β-клетки человека в среднем на 15 ± 3 мВ ( n = 7, 3 донора; P <0,01) (рис. 3 E ).

Рисунок 3

Влияние глицина на мембранный потенциал β-клеток человека. Регистрация мембранного потенциала выполняется с использованием конфигурации «перфорированный пластырь». A : Образец следа воздействия глицина (100 мкмоль / л) на β-клетки человека.Применение 100 мкмоль / л глицина вызывало значительное увеличение потенциала действия ( B ) и снижение высоты потенциала действия ( C ). D : Образец следа глицин-зависимой (100 мкмоль / л) деполяризации β-клеток до, во время и после нанесения 1 мкмоль / л стрихнина. E : изменение мембранного потенциала в ответ на 100 мкмоль / л глицина. * P <0,05 и ** P <0,01.

Глицин модулирует [Ca

2+ ] i в β-клетках

Затем мы исследовали эффекты глицина на [Ca 2+ ] i в островковых клетках человека.Идентичность всех клеток была подтверждена после экспериментов иммуноокрашиванием (фиг. 4 A ). Типичная запись от β-ячейки показана на рис. 4 B . Применение глицина увеличивало [Ca 2+ ] i в 50% (72 из 144) всех протестированных β-клеток (7 доноров). Ответы были аналогичными после добавления 100 мкмоль / л и 300 мкмоль / л глицина (55% и 42% отвечающих клеток соответственно) и исчезли в присутствии стрихнина (фиг. 4 B и C ).Интересно, что в 7% (10 из 144) β-клеток содержание глицина уменьшилось, а не увеличилось [Ca 2+ ] i , но в остальных 43% клеток явного эффекта не наблюдалось (рис. 4 ). D ). Мы сравнили исходный уровень [Ca 2+ ] i (до добавления глицина, при 6 ммоль / л внеклеточной глюкозы) в клетках, которые показали увеличение, отсутствие изменений и снижение [Ca 2+ ] i при нанесении глицина соответственно (рис. 4 E ). Клетки, которые ответили повышением [Ca 2+ ] i , имели значительно более низкий исходный уровень [Ca 2+ ] i , чем не ответившие, тогда как значительно более высокий исходный уровень [Ca 2+ ] i был наблюдается в клетках, показывающих снижение после введения глицина.При 1 ммоль / л глюкозы доля клеток, отвечающих увеличением [Ca 2+ ] i (73% [11 из 15 клеток], 2 донора), была выше, чем при 6 ммоль / л глюкозы (43% [41 из 97 клеток]) и при 10 ммоль / л глюкозы (56% [18 из 32 клеток], 4 донора). Это сопровождалось более низким исходным уровнем [Ca 2+ ] i при 1 ммоль / л глюкозы (0,74 ± 0,02 условных единиц [AU]) по сравнению с 6 ммоль / л глюкозы (1,08 ± 0,04 AU) и 10 ммоль / л. глюкоза (0,86 ± 0,02 АЕ). Четкое увеличение [Ca 2+ ] i при добавлении глицина иногда также наблюдалось в α-клетках (рис.4 F ), но доля отвечающих клеток была намного ниже по сравнению с β-клетками (11% [14 из 124 клеток], 6 доноров), что согласуется с более низкой долей α-клеток, которые проявляли глицин-активированный Cl ток. Они также обычно требовали более высокой концентрации глицина, при этом 7% клеток отвечали на 100 мкмоль / л и 19% отвечали на 300 мкмоль / л. Наконец, внеклеточный Ca 2+ был необходим для того, чтобы вызвать ответ (Fig. 4 G ), а отсутствие Ca 2+ подавляло ответ на глицин на 99.8% ( n = 35 клеток, 5 доноров; P <0,01) (рис. 4 H ). Дополнительные кривые и увеличенные временные шкалы для этих экспериментов показаны на дополнительном рисунке 4.

Рисунок 4

Влияние глицина на [Ca 2+ ] i в островковых клетках. A : Ратиометрические изображения были записаны в диспергированных островковых клетках с последующим определением типов клеток с помощью иммуноокрашивания. SST, соматостатин. B : Типичный след показывает влияние глицина (Gly) (100/100/300 мкмоль / л) на [Ca 2+ ] i в β-клетке в отсутствие или в присутствии стрихнина (Strych) ( 1 мкмоль / л). C : Площадь под кривой (AUC) во время 1-минутного нанесения 100 мкмоль / л глицина в отсутствие или в присутствии стрихнина (1 мкмоль / л) в тех же клетках ( n = 39 клеток из 9 экспериментов). Базовые значения (до нанесения глицина) вычитали. D : Следы от трех β-клеток из одного и того же эксперимента, иллюстрирующие различные типы ответов [Ca 2+ ] i на глицин (100/300 мкмоль / л). Кривые показаны в масштабе (т. Е. Без корректировки базовых значений). E : исходные соотношения флуоресценции (до нанесения глицина) в β-клетках, которые ответили увеличением, отсутствием изменений или уменьшением [Ca 2+ ] i , соответственно ( n = 38, 40, и 10). Данные представлены в виде прямоугольных диаграмм (квадраты, средние; линии, медианы; прямоугольники, 25/75 процентили; усы, минимальные / максимальные значения). F : Влияние глицина (300 мкмоль / л) на [Ca 2+ ] и в α-клетке. G : характерный след показывает влияние глицина на [Ca 2+ ] i в отсутствие или в присутствии внеклеточного Ca 2+ и ответ Ca 2+ на 70 ммоль / л KCl. H : AUC во время 1-минутного нанесения 100 мкмоль / л глицина в отсутствие или в присутствии внеклеточного Ca 2+ . ** P <0,01 и *** P <0,001.

Взаимодействие между глицином и инсулином

Инсулин усиливает токи Cl в нейронах (27,28). Мы исследовали, играет ли инсулин роль в усилении передачи сигналов глицина в островках человека. В β-клетках, обработанных инсулином с концентрацией 10 мкмоль / л, вызванный глицином ток усиливался на 54 ± 17% ( n = 23, 8 доноров; P <0.01) по сравнению с контрольными клетками (рис. 5 Ai и B ). Мы подтвердили аналогичные результаты в ответ на лечение инсулином 100 нмоль / л (данные не показаны). Мы подозревали, что это было результатом передачи сигналов между рецептором инсулина и GlyR, поэтому мы предварительно инкубировали клетки с 100 нмоль / л вортманнина, ингибитора фосфоинозитид-3-киназы, для подавления передачи сигналов рецептора инсулина. Вортманнин предотвращал инсулино-зависимое усиление вызванного глицином тока у доноров без СД2 (увеличение на 6 ± 4%, n = 12 клеток, 5 доноров; незначительно) (рис.5 Aii и B ). Интересно, что β-клетки от доноров с T2D не показали усиления вызванного глицином тока в ответ на инсулин (изменение на 5-9% от исходного уровня, n = 13 клеток, 4 донора; незначительно) (рис. 5). Aiii и B ).

Рисунок 5

Взаимодействие глицин-инсулин. A : Типичный след инсулинозависимой амплификации тока глицина в человеческих β-клетках от донора без T2D ( i ), β-клетках, предварительно инкубированных с 100 нмоль / л вортманнина в течение 1 часа ( ii ), и β -клетки от доноров с T2D ( iii ).Контрольные токи глицина до лечения показаны черным цветом, а токи глицина после обработки инсулином 10 мкмоль / л в течение 1 мин показаны серым цветом. Аналогичные результаты были получены с инсулином 100 нмоль / л (данные не показаны). B : Площадь под кривой (AUC), нормализованная для управления токами глицина. При 6 ммоль / л глюкозы 300 мкмоль / л глицина умеренно увеличивает секрецию инсулина, тогда как 800 мкмоль / л глицин сильно увеличивает секрецию инсулина. C : Глицин индуцировал секрецию инсулина в интактных островках человека.Глицин дозозависимо увеличивал секрецию инсулина в зависимости от стрихнина. D : Динамическая перифузия секреции инсулина, стимулированная глюкозой, в контрольных и человеческих островках, обработанных стрихнином. P <0,001 по двустороннему дисперсионному анализу. E : AUC стимулированной глюкозой перифузии инсулина в отсутствие или в присутствии 1 мкмоль / л стрихнина. ** P <0,01 по сравнению с контролем 300 мкмоль / л глицина ( B ) или 0 глицина ( C ).

Как предполагалось в предыдущих исследованиях in vivo (18,19), мы подтвердили способность глицина индуцировать секрецию инсулина.При циркулирующих концентрациях 300 мкмоль / л глицин имел тенденцию увеличивать секрецию инсулина (изменение в 23 ± 8% по сравнению с контролем, n = 18 повторов, 6 доноров) (фиг. 5 C ) из интактных островков. Поскольку ожидается, что интерстициальная концентрация глицина превысит циркулирующий уровень, особенно потому, что β-клетки накапливают и высвобождают глицин (см. Ниже), мы также стимулировали интактные островки с помощью 800 мкмоль / л глицина. Эта концентрация, которая достигается при пероральном приеме глицина (18), дополнительно увеличивает секрецию инсулина (изменение в 34 ± 12%, n = 18 повторов, 6 доноров; P <0.01) (рис. 5 C ) по сравнению с контролем. Антагонизм GlyR с 1 мкмоль / л стрихнина предотвращал глицин-зависимую секрецию инсулина в интактных островках при 300 и 800 мкмоль / л глицина (фиг. 5 C ). Мы дополнительно исследовали роль эндогенной передачи сигналов глицина в секреции инсулина, исследуя влияние стрихнина на динамические ответы секреции инсулина на высокий уровень глюкозы (рис. 5 D ). Стрихнин снижает стимулированную глюкозой секрецию инсулина островками человека ( n = 10 повторов, 5 доноров; P <0.001 двусторонним дисперсионным анализом; площадь под кривой P = 0,054) (рис.5 E ).

Высвобождение глицина из β-клеток человека

Островки поджелудочной железы крысы содержат ~ 6 ммоль / л глицина (29). Иммуногистохимия и электронная микроскопия иммунного золота показывают, что β-клетки крысы экспрессируют везикулярный переносчик аминокислот (VIAAT / VGAT), который опосредует захват глицина синаптическими пузырьками в нейронах и накапливает глицин в секреторных гранулах (30). Эти данные и способность стрихнина ингибировать секрецию инсулина островками человека (см. Выше) предполагают, что β-клетки могут высвобождать глицин путем экзоцитоза, опосредуя аутокринную передачу сигналов.С помощью флуоресцентной иммуногистохимии мы обнаружили, что островковые клетки человека экспрессируют оба из GlyT, GlyT1 и GlyT2, которые, по-видимому, локализуются как в β-, так и в не-β-клетках (рис. 6 A и B и дополнительный рис. 5). . Мы исследовали высвобождение глицина из β-клеток, адаптировав анализ на основе патч-кламп, который ранее использовался для обнаружения экзоцитотического высвобождения γ-аминомасляной кислоты (ГАМК) и АТФ (3,31,32). Изолированные островковые клетки человека трансфицировали плазмидным вектором, сверхэкспрессирующим GlyRα1, что приводило к примерно семикратному увеличению вызванных глицином токов.Эти GlyR будут ощущать высвобождение глицина из одних и тех же клеток, вызывая токи, которые легко обнаружить. Трансфицированные клетки стимулировали инфузией 2 мкмоль / л свободного Ca 2+ . Типичный эксперимент показан на рис. 6 Ci . На фоновый ток накладываются спонтанные переходные внутренние токи (TIC). Они активировались быстро (6,4 ± 2,5 мс, время нарастания 10–90%, n = 7, 2 донора) и распадались более постепенно, с полушириной 10,5 ± 3,5 мс, напоминающей тормозные постсинаптические токи в нейронах.TICs полностью подавлялись стрихнином (Fig. 6 Cii ), предполагая, что каждый TIC отражает экзоцитоз глицинсодержащей везикулы.

Фиг.6.

Секреция глицина β-клетками человека и активность GlyT. Срезы ткани поджелудочной железы человека иммуноокрашивали на GlyT1 ( A ) (красный), GlyT2 ( B ) (красный) и инсулин (зеленый). Ядра окрашивали DAPI (синий). C : β-Клетки, сверхэкспрессирующие субъединицы GlyRα1, зажимали при -70 мВ и вводили внутриклеточный раствор, содержащий ~ 2 мкмоль / л свободного Ca 2+ .Воспламенение TIC ( i ) подавлялось в присутствии 1 мкмоль / л стрихнина ( ii ). D : Суммарный след TIC глицина от контрольных клеток и после замены Na + на Li + для блокирования активности GlyT. E : Общее время затухания от TIC. F : Образец следа экспериментов с остановленным потоком для оценки клиренса глицина из контрольных клеток и после замены Na + на Li + для блокирования активности GlyT. G : Общее время затухания из экспериментов с остановленным потоком.* P <0,05 по сравнению с контролем.

Концентрация глицина в спинномозговой жидкости составляет ∼5 мкмоль / л (33), тогда как уровни глицина в плазме примерно в 40 раз выше (150–400 мкмоль / л) (8,18). Эти уровни глицина в плазме выше половины максимальной эффективной концентрации (EC 50 ) GlyR в β-клетках (см. Выше), и лиганд-зависимые ионные каналы снижают чувствительность во время длительного воздействия высоких концентраций агонистов. Для определения того, очищают ли β-клетки от глицина за счет активности GlyT, чтобы поддерживать низкую внутриостровную концентрацию глицина, использовали два метода.Во-первых, мы исследовали клиренс после высвобождения эндогенного глицина. Поскольку GlyT требует Na + для совместной транспортировки глицина, внеклеточный Na + был заменен на Li + для эффективного ингибирования как GlyT1, так и GlyT2 (34). β-Клетки, сверхэкспрессирующие GlyRα1, стимулировали к секреции глицина в присутствии и в отсутствие Na + , и был охарактеризован клиренс глицина. На рисунке 6 D показано усредненное событие TIC с заменой Na + на Li + и без нее ( n = 7 клеток, 21 событие, 2 донора для контроля; n = 5 клеток, 58 событий. , 2 донора на Li + замена ).Замена Li + значительно увеличила общее время распада TIC глицина с 18 ± 6 до 42 ± 6 мс ( P <0,05) (фиг. 6 E ).

Во-вторых, мы исследовали клиренс экзогенного глицина в эксперименте с остановленным потоком (34). После быстрого местного применения глицина 100 мкмоль / л вместо применения внеклеточного раствора для смывания локально высокой концентрации глицина и предотвращения десенсибилизации рецепторов системы перфузии были остановлены. В этом сценарии внеклеточный глицин в первую очередь удаляется за счет диффузии и активности GlyT.На рис. 6 F показан образец следа эксперимента с остановленным потоком. После замены Li + клеткам требовалось больше времени (74 ± 9 с) для возврата к исходному уровню по сравнению с их контролем (43 ± 4 с, n = 10 клеток, 3 донора; P <0,05) (рис. 6 G ).

Обсуждение

В текущем исследовании мы обнаружили, что GlyR и GlyT высоко экспрессируются в β-клетках человека и что активация GlyR стимулирует электрическую активность, увеличивает [Ca 2+ ] i и усиливает секрецию инсулина.Недавно сообщалось, что GlyR в островках человека экспрессируется специфически в α-клетках, но не в β-клетках (35), что подтверждается открытием, что глицин стимулировал секрецию глюкагона, но не секрецию инсулина из островков человека. Однако эксперименты проводились в отсутствие глюкозы, что приводит к активации нефизиологически больших токов K ATP в β-клетках и может предотвратить любое влияние глицина на мембранный потенциал. Ли и др. (35) наблюдали [Ca 2+ ] i ответы на применение глицина в подмножестве диспергированных островковых клеток, но однозначная идентификация типов клеток не проводилась.Наши данные четко демонстрируют, что среди островковых клеток человека GlyR и токи Cl , активируемые глицином, наиболее активны в β-клетках.

Эффект глицина на [Ca 2+ ] i в β-клетках блокировался антагонистом GlyR стрихнином, демонстрируя, что это не было вторичным по отношению к Na + -зависимому захвату аминокислоты, как сообщалось ранее. для β-клеток мыши (36). Текущая активность GlyR была значительно ниже в β-клетках мыши по сравнению с β-клетками человека и не определялась в β-клетках крыс.Это наблюдение дополняет ранее описанные различия между островками человека и грызунов (25,37,38). Можно предположить, что это отражает различия в диетах: содержание глицина в мясе (6,5% аминокислот [39]) более чем вдвое превышает содержание пшеничного белка (2,8% аминокислот [40]).

В отличие от GlyR в центральной нервной системе, которые являются ингибирующими, мы демонстрируем, что активация GlyR поджелудочной железы увеличивала [Ca 2+ ] i в большинстве β-клеток, но имела ингибирующий эффект в небольшой популяции клеток.Как можно объяснить эти расходящиеся эффекты? Активация проницаемого для Cl GlyR будет приводить мембранный потенциал в сторону равновесного потенциала Cl (E Cl ). Ранее мы сообщали, что E Cl в β-клетках составляет ~ -40 мВ, что выше порога для электрической активности (1). Наши данные предполагают, что некоторые β-клетки были деполяризованы за пределами E Cl перед добавлением глицина и что глицин, следовательно, гиперполяризовал, а не деполяризовал эти клетки и, таким образом, уменьшил [Ca 2+ ] i .В подтверждение этого, клетки, отвечающие снижением [Ca 2+ ] i , показали значительно более высокий исходный уровень [Ca 2+ ] i , чем клетки, которые ответили увеличением. Положительный E Cl по сравнению с нейронами (<–60 мВ) отражает более высокую внутриклеточную концентрацию Cl в β-клетках (41).

Концентрация глицина в плазме примерно в 40 раз выше, чем в спинномозговой жидкости, и выше EC 50 для активации GlyR.Действительно, мы полагаем, что локальная внеклеточная концентрация глицина в островках значительно ниже из-за GlyT-зависимого клиренса глицина. Эти переносчики очень эффективны при очистке от глицина (V max = 379 пмоль / мин / мг для GlyT1 и 5730 пмоль / мин / мг для GlyT2 [42]), и активность GlyT стимулируется по мере того, как клетка становится более гиперполяризованной (т. Е. в периоды покоя или между характерными медленными волнами деполяризации β-клеток [34]). Наши эксперименты показывают, что ингибирование GlyT посредством замены Li + приводит почти к удвоению эндогенного сигнала глицина, предполагая, что GlyT не только очищает глицин плазмы, но также регулирует передачу сигналов глицина в клетках.Точно так же экзогенное применение глицина в экспериментах с остановленным потоком продемонстрировало значительную потерю клиренса глицина во время ингибирования GlyT, и это, вероятно, преувеличено в ограниченном межклеточном пространстве, в отличие от изолированных клеток, изученных здесь.

Мы исследовали, секретируется ли глицин из β-клеток, выполнив эксперименты с патч-зажимом в клетках, сверхэкспрессирующих GlyR, которые служат сенсорами для глицина, высвобождаемого из той же клетки (т.е. аутосинапс). Хотя эксперименты в принципе должны быть осуществимы на нетрансфицированных клетках, сверхэкспрессия GlyR значительно повышает чувствительность анализа.Мы обнаружили, что инфузия Ca 2+ вызывает TIC, которые отражают экзоцитотическое высвобождение GlyR-активирующего соединения. Вероятно, что это соединение в основном представляет собой глицин, секретируемый гранулами инсулина, синаптическими микровезикулами или и тем, и другим (30), но мы не можем исключить таурин, который также присутствует в высоких концентрациях в островках (29). Подобно рецепторам GABA и GABA A (1) и рецепторам ATP и P2 (2,3), аутокринная активация GlyR может составлять положительную аутокринную петлю обратной связи в β-клетках человека.

Прием глицина снижает уровень глюкозы в крови (18), и было высказано предположение, что глицин стимулирует секрецию инсулина у людей. Хотя физиологический глицин (300 мкмоль / л) имел тенденцию только увеличивать секрецию инсулина, глицин в концентрации 800 мкмоль / л значительно увеличивал секрецию инсулина. Мы полагаем, что в исследованиях секреции инсулина, где островки были интактными, клетки в ядре островков не испытывали таких же концентраций глицина, как клетки на внешней стороне, что объясняет несоответствие в концентрациях глицина, вызывающих реакцию.Помимо демонстрации способности глицина стимулировать инсулин, мы продемонстрировали, что инсулин также отвечает за усиление тока глицина и что для этого требуется активация фосфоинозитид-3-киназы, которая находится ниже по течению от рецептора инсулина. Хотя мы не пытались использовать антагонисты рецепторов инсулина, наши результаты согласуются с зависимым от рецептора инсулином усилением тока глицина в спинномозговых нейронах мышей (27).

Наконец, мы продемонстрировали, что β-клетки от доноров с T2D имеют значительно более низкую экспрессию GlyR, более низкий ток Cl , активируемого глицином, чем β-клетки от доноров без T2D, и невосприимчивы к эффектам инсулина, что, возможно, подразумевает Инсулинорезистентность β-клеток как вклад в снижение экспрессии GlyR при СД2.Точный механизм подавления GlyRα1 в этих клетках неясен, но может быть связан с нарушением транспорта или активности перед лицом инсулинорезистентности β-клеток или снижением уровня белка ниже экспрессии мРНК, которая увеличивалась при T2D (дополнительный рисунок 1 ). В ).

Таким образом, мы демонстрируем здесь, что каналы GlyR Cl высоко экспрессируются в β-клетках человека и способствуют регуляции электрической активности и передаче сигналов [Ca 2+ ] i через аутокринную петлю обратной связи с инсулином. .Наши результаты обеспечивают физиологическую основу для ранее наблюдаемого положительного влияния аминокислоты на толерантность к глюкозе у человека и потенциального механизма, способствующего нарушению секреции инсулина при СД2.

Информация о статье

Благодарности. Авторы благодарят старшего автора этой работы, покойного доктора Матиаса Брауна, за руководство и видение в этом исследовании, и их соавтора, покойного Стивена Чели, за его усилия и вклад во время его пребывания с их группой в Эдмонтоне.Авторы благодарят докторов наук. Куан Чжан и Патрик Рорсман (Оксфорд) за полезные комментарии, которые способствовали завершению этой рукописи, а также Алию Спигельман (Эдмонтон) и Нэнси Смит (Эдмонтон) за помощь в анализе человеческого инсулина. Островки человека были предоставлены Лабораторией выделения клинических островков Университета Альберты (доктора Джеймс Шапиро и Тацуя Кин) и Институтом диабета Альберты IsletCore. Авторы благодарят программы по закупке и обмену человеческих органов (HOPE) и Trillium Gift of Life Network (TGLN) за усилия по получению поджелудочной железы человека для исследований.

Финансирование. R.Y.-D. была поддержана стипендиями от Диабетического фонда Альберты. Завершение этой работы было частично профинансировано за счет операционного гранта P.E.M. от Канадских институтов исследований в области здравоохранения (MOP 310536). P.E.M. заведует кафедрой канадских исследований в области биологии островков.

Двойственность интересов. О потенциальных конфликтах интересов, относящихся к этой статье, не сообщалось.

Вклад авторов. R.Y.-D., E.D., J.E.M.F., X.D., K.S., S.K., A.B., M.F., J.L., X.W., S.C. и M.B. исследовали данные и проанализировали результаты. М.Б. написал частичный черновик рукописи, который завершил Р.Я.-Д. и P.E.M. P.E.M. является гарантом этой работы и, как таковой, имеет полный доступ ко всем данным в исследовании и берет на себя ответственность за целостность данных и точность анализа данных.

  • Получено 9 сентября 2015 г.
  • Принято 26 апреля 2016 г.
  • © Американская диабетическая ассоциация, 2016 г.Читатели могут использовать эту статью при условии, что произведение правильно процитировано, используется в образовательных целях, а не для получения прибыли, и если работа не изменена.

Серин и глицин необходимы для увеличения популяции клеток-предшественников мышечной ткани человека

% PDF-1.7 % 1 0 объект > / Метаданные 4 0 R / Страницы 2 0 R / StructTreeRoot 3 0 R / Тип / Каталог / Viewer Настройки 5 0 R >> эндобдж 4 0 obj > поток application / pdf

  • [email protected]
  • Серин и глицин необходимы для увеличения популяции мышечных клеток-предшественников человека
  • Microsoft Word2019-11-06T23: 51: 55Z2021-04-27T15: 51: 04-07: 002021-04-27T15: 51: 04-07: 00uuid: E4E47BA6-143C-4477-B3CD-F7C2A56E6F58uuid: 7c639402-1dd2-11b2 -0a00-6a0000000000 конечный поток эндобдж 2 0 obj > эндобдж 3 0 obj > эндобдж 5 0 obj > эндобдж 161 0 объект > эндобдж 162 0 объект > эндобдж 164 0 объект [216 0 R 217 0 R 218 0 R 219 0 R 220 0 R 221 0 R 558 0 R 559 0 R 560 0 R 223 0 R 224 0 R 225 0 R 226 0 R 227 0 R 228 0 R 229 0 R 230 0 R 231 0 R 232 0 R 233 0 R 234 0 R 235 0 R] эндобдж 165 0 объект > эндобдж 166 0 объект [236 0 R 237 0 R 238 0 R 239 0 R 240 0 R] эндобдж 167 0 объект [241 0 R 242 0 R 244 0 R 245 0 R 246 0 R 247 0 R 248 0 R 249 0 R 250 0 R 243 0 R] эндобдж 168 0 объект [251 0 R 252 0 R] эндобдж 169 0 объект [253 0 R 254 0 R 255 0 R 256 0 R 257 0 R 258 ​​0 R] эндобдж 170 0 объект [259 0 R 260 0 R 261 0 R 262 0 R] эндобдж 171 0 объект [263 0 R 264 0 R] эндобдж 172 0 объект [265 0 R 562 0 R 563 0 R 564 0 R 565 0 R 267 0 R 268 0 R 269 0 R 270 0 R 271 0 R] эндобдж 173 0 объект [272 0 R 273 0 R 274 0 R] эндобдж 174 0 объект [275 0 R 276 0 R 277 0 R 278 0 R] эндобдж 175 0 объект [279 0 R 280 0 R 281 0 R 282 0 R 283 0 R 284 0 R 285 0 R 286 0 R 287 0 R 288 0 R] эндобдж 176 0 объект [289 0 R 290 0 R 291 0 R 292 0 R] эндобдж 177 0 объект [293 0 R 295 0 R 296 0 R 294 0 R] эндобдж 178 0 объект [297 0 R 571 0 R 572 0 R 573 0 R 574 0 R 575 0 R 576 0 R 299 0 R 300 0 R 301 0 R 302 0 R 303 0 R 304 0 R 305 0 R 306 0 R] эндобдж 179 0 объект [307 0 R 308 0 R] эндобдж 180 0 объект [309 0 R 310 0 R] эндобдж 181 0 объект [311 0 R 584 0 R 585 0 R 586 0 R 587 0 R 588 0 R 589 0 R 313 0 R 314 0 R 315 0 R] эндобдж 182 0 объект [316 0 R 317 0 R 318 0 R] эндобдж 183 0 объект [319 0 R 321 0 R 320 0 R] эндобдж 184 0 объект [322 0 R 597 0 R 598 0 R 599 0 R 600 0 R 601 0 R 602 0 R 603 0 R 604 0 R 605 0 R] эндобдж 185 0 объект [618 0 R 325 0 R 326 0 R 327 0 R 328 0 R 329 0 R 330 0 R 331 0 R 332 0 R 333 0 R 334 0 R 335 0 R 336 0 R 337 0 R 338 0 R 339 0 R 340 0 341 руб. 0 342 руб. 0 343 руб. 0 344 руб.] эндобдж 186 0 объект [345 0 R 346 0 R 347 0 R 348 0 R] эндобдж 187 0 объект [349 0 R 350 0 R] эндобдж 188 0 объект [351 0 R 353 0 R 354 0 R 619 0 R 352 0 R] эндобдж 189 0 объект [629 0 R 630 0 R 631 0 R 632 0 R 633 0 R 634 0 R 357 0 R 358 0 R 359 0 R 360 0 R 361 0 R 362 0 R 363 0 R] эндобдж 190 0 объект [364 0 R 365 0 366 0 R] эндобдж 191 0 объект [367 0 R 368 0 R] эндобдж 192 0 объект [369 0 R 370 0 R 371 0 R] эндобдж 193 0 объект [372 0 R 373 0 R] эндобдж 194 0 объект [374 0 R 375 0 R 376 0 R 377 0 R 378 0 R 379 0 R 380 0 R 381 0 R 382 0 R 383 0 R 384 0 R 385 0 R] эндобдж 195 0 объект [386 0 R 387 0 R 388 0 R 389 0 R 390 0 R 391 0 R 392 0 R] эндобдж 196 0 объект [393 0 R 394 0 R 395 0 R 396 0 R 397 0 R] эндобдж 197 0 объект [398 0 R 399 0 400 0 R] эндобдж 198 0 объект [401 0 R 402 0 R 403 0 R 404 0 R 405 0 R] эндобдж 199 0 объект [406 0 R 407 0 R 408 0 R 409 0 R 410 0 R] эндобдж 200 0 объект [411 0 R 412 0 R 413 0 R 414 0 R 415 0 R] эндобдж 201 0 объект [416 0 R 417 0 R 418 0 R 419 0 R 420 0 R 421 0 R 422 0 R] эндобдж 202 0 объект [423 0 R 424 0 R 425 0 R 426 0 R 427 0 R 428 0 R 429 0 R] эндобдж 203 0 объект [430 0 R 430 0 R 431 0 R 432 0 R 433 0 R 434 0 R 435 0 R 436 0 R 437 0 R 438 0 R 439 0 R] эндобдж 204 0 объект [440 0 R 441 0 R 442 0 R 443 0 R 444 0 R 445 0 R 446 0 R 447 0 R 448 0 R 449 0 R 450 0 R 451 0 R 452 0 R 453 0 R 454 0 R 455 0 R] эндобдж 205 0 объект [456 0 R 457 0 R 458 0 R 459 0 R 460 0 R 461 0 R 462 0 R 463 0 R 464 0 R 465 0 R] эндобдж 206 0 объект [466 0 R 467 0 R 468 0 R 469 0 R 470 0 R 471 0 R 472 0 R 473 0 R 474 0 R] эндобдж 207 0 объект [475 0 R 476 0 R 477 0 R 478 0 R 479 0 R 480 0 R 481 0 R 482 0 R] эндобдж 208 0 объект [483 0 R 484 0 R 485 0 R 486 0 R 487 0 R 488 0 R 489 0 R 490 0 R 491 0 R] эндобдж 209 0 объект [492 0 R 493 0 R 494 0 R 495 0 R 496 0 R 497 0 R 498 0 R 499 0 R 500 0 R] эндобдж 210 0 объект [501 0 R 502 0 R 503 0 R 504 0 R 505 0 R 506 0 R 507 0 R 508 0 R 509 0 R] эндобдж 211 0 объект [510 0 R 511 0 R 512 0 R 513 0 R 514 0 R 515 0 R 516 0 R 517 0 R 518 0 R] эндобдж 212 0 объект [519 0 R 520 0 R 521 0 R 522 0 R 523 0 R 524 0 R 525 0 R 526 0 R 527 0 R 528 0 R 529 0 R 530 0 R 531 0 R 532 0 R 533 0 R] эндобдж 213 0 объект [534 0 R 536 0 R 537 0 R 635 0 R 539 0 R 540 0 R 541 0 R 542 0 R 543 0 R 544 0 R 545 0 R 535 0 R] эндобдж 214 0 объект [546 0 R 548 0 R 549 0 R 550 0 R 551 0 R 638 0 R 553 0 R 554 0 R 555 0 R 547 0 R] эндобдж 215 0 объект [556 0 R 557 0 R] эндобдж 556 0 объект > эндобдж 557 0 объект > эндобдж 163 0 объект > эндобдж 56 0 объект > / MediaBox [0 0 612 792] / Parent 2 0 R / Resources> / Font> / ProcSet [/ PDF / Text] >> / StructParents 51 / Tabs / S / Type / Page >> эндобдж 642 0 объект [646 0 R 647 0 R] эндобдж 643 0 объект > поток HVn8} G) R7JmQqAM6)% [, lI + N; $ [v4u (篲 TY Nbfb! DYwg (a @! D.؅:>: K, ¢ $ .n

    Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка вашего браузера для приема файлов cookie

    Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
    • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
    • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *