Содержание

«Глицин форте» или «Билобил»? – meds.is

Сравнение эффективности Глицина фортя и Билобила

Эффективность у Глицина фортя достотаточно схожа с Билобилом – это означает, что способность лекарственного вещества оказывать максимально возможное действие схоже.

Например, если терапевтический эффект у Глицина фортя более выраженный, то при применении Билобила даже в больших дозах не получится добиться данного эффекта.

Также скорость терапии – показатель быстроты терапевтического действия у Глицина фортя и Билобила примерно одинаковы. А биодоступность, то есть количество лекарственного вещества, доходящее до места его действия в организме, схожа. Чем выше биодоступность, тем меньше его потерь будет при усвоении и использовании организмом.

Сравнение безопасности Глицина фортя и Билобила

Безопасность препарата включает множество факторов.

При этом у Глицина фортя она достаточно схожа с Билобилом. Важно, где метаболизируется препарат: лекарственные вещества выделяются из организма либо в неизмененном виде, либо в виде продуктов их биохимических превращений. Метаболизм протекает спонтанно, но чаще всего задействует основные органы, такие как печень, почки, лёгкие, кожу, мозг и другие. При оценивании метаболизма у Глицина фортя, также как и у Билобила мы смотрим, какой орган является метаболизирующим и наколько критично действие на него.

Соотношение риска к пользе – это когда назначение лекарственного препарата нежелательно, но оправдано при определенных условиях и обстоятельствах, с обязательным соблюдением осторожности применения. При этом у Глицина фортя нет никаих рисков при применении, также как и у Билобила.

Также при рассчете безопасности учитывается проявляются ли только аллергические реакции или же возможная дисфункция основных органов. В прочем как и обратимость последствий от использования Глицина фортя и Билобила.

Сравнение противопоказаний Глицина фортя и Билобила

Исходя из инструкции. Количество противопоказаний у Глицина фортя достаточно схоже с Билобилом и составляет малое количество. Это и перечень симптомов с синдромами, и заболевания, различные внешних и внутренние условия, при которых применение Глицина фортя и Билобила может быть нежелательным или недопустимым.

Сравнение привыкания у Глицина фортя и Билобила

Как и безопасность, привыкание тоже включает множество факторов, которые необходимо учитывать при оценивании препарат.

Так совокупность значения таких параметров, как «cиндром отмены» и «развитие резистентности», у Глицина фортя достаточно схоже со аналогичными значения у Билобила. Синдром отмены – это патологическое состояние, возникающее после прекращения поступления в организм веществ, вызывающих привыкание или зависимость. А под резистентностью понимают изначальную невосприимчивость к препарату, этим она отличается от привыкания, когда невосприимчивость к препарату развивается в течение определенного периода времени. Наличие резистентности можно констатировать лишь в том случае, если была сделана попытка увеличить дозу препарата до максимально возможной. При этом у Глицина фортя значения «синдрома отмены» и «резистентности» достотачно малое, впрочем также как и у Билобила.

Сравнение побочек Глицина фортя и Билобила

Побочки или нежелательные явления – это любое неблагоприятное с медицинской точки зрения событие, возникшее у субъекта, после введения препарата.

У Глицина фортя состояния нежелательных явлений почти такое же, как и у Билобила. У них у обоих количество побочных эффектов малое. Это подразумевает, что частота их проявления низкая, то есть показатель сколько случаев проявления нежелательного эффекта от лечения возможно и зарегистрировано – низкий. Нежелательное влияние на организм, сила влияния и токсическое действие у Глицина фортя схоже с Билобилом: как быстро организм восстановиться после приема и восстановиться ли вообще.

Сравнение удобства применения Глицина фортя и Билобила

Это и подбор дозы с учетом различных условий, и кратность приемов. При этом важно не забывать и про форму выпуска препарата, ее тоже важно учитывать при составлении оценки.

Удобство применения у Глицина фортя примерно одинаковое с Билобилом. При этом они не являются достаточно удобными для применения.

Рейтинг препаратов составлен опытными фармацевтами, изучающий международные исследования. Отчет сгенерирован автоматически.

Дата последнего обновления: 2020-12-04 13:42:53

Что лучше Циннаризин или Глицин?

К употреблению лекарственных препаратов необходимо подходит ответственно. Лучше, если их назначает специалист, хорошо владеющий ситуацией. Самолечение может привести к проблемам, особенно если оно применяется не по назначению.

В любом случае, необходимо собрать полную информацию о лекарстве. Например: Циннаризин или Глицин. Какой из них лучше? Кому и в каком случае каждый из них подойдет?

Циннаризин: особенности препарата

Препарат относится к группе, применяемой в лечении нервной системы. В частности: при нарушении работы вестибулярного аппарата. Терапевтический эффект осуществляется за счёт циннаризина — основного действующего вещества. Обладает антигистаминным свойством.

Производят белые или почти белые таблетки: по 25 мг/0,025 г

активного вещества в каждой (120/50 в упаковке).

Какое действие оказывает препарат:

  1. Блокирует кальциевые каналы — это снижает спазмы в сосудах мозга.
  2. Усиливает микроциркуляцию крови, снижает вязкость крови.
  3. Увеличивает клеточную резонансность к кислородному голоданию.
  4. Предотвращает или полностью устраняет головокружение.

Спустя 1-3 часа лекарство обнаруживается в плазме крови. Обменные процессы происходят под влиянием определенных печеночных ферментов. Продукты распада выводятся с мочой, калом.

Циннаризин назначают при следующих заболеваниях:

  • Цереброваскулярные нарушения, сопровождающиеся головокружением, ушным звоном, головной болью разной интенсивности, преимущественно из-за сосудов, вспыльчивостью, ослаблением памяти, недостатком концентрации внимания.
  • Периферические сосудистые нарушения циркуляции крови, проявляющиеся: холодными конечностями. трофическими, варикозными изьявлениями. онемением, судорогами.
  • Лабиринтные расстройства с головокружением, тошнотой, рвотой, ушным шумом.
  • Профилактика кинетоза (морская болезнь).

Лекарство имеет незначительные противопоказания: гиперчувствительность к циннаризину или к любому дополнительному веществу. беременность. лактация. порфирии. печеночная или почечная недостаточность.

Употреблять его лучше во время еды, так как он раздражающе влияет на слизистые ЖКТ.

Побочные реакции: набор лишней массы тела. мышечная слабость, гиперпотливость, КПЛ, холестатическая желтуха, нарушение работы ЖКТ, нервной, иммунной системы.

Глицин: особенности препарата

Лекарство используют для лечения неврологических расстройств. Как центральный нейромедиатор регулирует обменные процессы в ЦНС, усиливает процессы метаболизма в тканях головного мозга. Может выступать как антидепрессант, оказывая седативное влияние.

Проявляет себя как антитоксическое и антиоксидантное средство. Успокаивает, снижая психоэмоциональное перенапряжение.

Повышает настроение, улучшает качество ночного сна. Повышает умственную работоспособность.

Весь этот эффект осуществляется за счёт глицина, который относится к заменимой аминокислоте, и дополнительных компонентов.

Выпускается в форме белых сублингвальных таблеток по 50 шт в упаковке. Каждая содержит 100 мг активного вещества.

Глицин применяют в терапии следующих нарушений:

  • Снижение умственной работоспособности.
  • Психоэмоциональное перенапряжение из-за стрессовых ситуаций.
  • Отклоняющееся поведение личности у детей и взрослых.
  • Полиэтиологический синдром.
  • Невроз и состояния, связанные с ним.
  • Энцефалопатия, включая алкогольную.
  • Эмоциональная нестабильность.
  • Бессонница.
  • Слабоумие.
  • Нарушение мозгового кровообращения, вызванного ишемическим инсультом.
  • Алкогольная зависимость (глицин — вспомогательное средство).

Лекарство не применяют в лечении лиц, страдающих артериальной гипотензией, имеющих индивидуальную непереносимость, не достигших 3-х летнего возраста, беременных и кормящих.

Могут возникнуть побочные реакции в виде: сыпи, ринита, воспаления конъюнктивы, общей слабости.

Что общего между Циннаризином и Глицином

Оба препарата применяют в лечении нервной системы. Выпускаются в форме таблеток. Имеют минимальное количество противопоказаний. Не применяются во время беременности, лактации.

Какие отличия обнаруживаются при сравнении

Циннаризин направлен на восстановление вестибулярного аппарата. Глицин — на восстановление процессов в тканях головного мозга. Это разные направления, хотя и в пределах нервной системы.

Поэтому показания отличаются.

Циннаризин имеет гораздо больше побочных эффектов, затрагивая практически все системы жизнедеятельности. Глицин — больший спектр положительного терапевтического воздействия.

Циннаризином лечат детей, достигших 12-летнего возраста, а Глицином — с 3-летнего возраста.

Какой препарат и для кого лучше подойдет

Циннаризин подойдёт тем, у кого:

  1. Нарушение кровообращения по системе сосудов головного мозга, нарушение координации движения — рекомендованная доза 1 таб/3 раза на день.
  2. Нарушение кровообращения в капиллярах. Назначают 2-3 таб/2-3 раза
    — суточная доза.
  3. Морская болезнь — таблетка перед поездкой. Возможно повторение через 6 часов.

Учитывая, что препарат вызывает сонливость, принимая его, запрещается управление транспортом.

Препарат содержит лактозу, его осторожно назначают тем, у кого непереносимость данного вещества.

Глицин подойдёт тем, у кого:

  1. Сниженная умственная работоспособность, память, концентрация внимания, девиантные формы поведения, задержка умственного развития, психоэмоциональное перенапряжение. Рекомендованная доза — 1 таб/2-3 раза. Продолжительность лечения до 30 дней.
  2. Вегето-сосудистая дистония, неврозы и состояния связанные с ними, осложнения, вызванные нейроинфекций и мозговой травмой, органическое поражение головного мозга. Дозировка: 1 таб/2-3 раза на день. Курс до двух недель.
  3. Нарушение сна. Дозировка — таблетка перед сном.
  4. Алкоголизм. По 1 таб/2-3 раза на день. Курс до 30 дней. Применяют как вспомогательное средство.

Больным с артериальной гипотензией дозировка подбирается индивидуально.

9 натуральных ноотропов, которые наука считает перспективными

Ноотропы — это вещества, которые стимулируют работу мозга. В теории они могут помочь быстрее думать, лучше запоминать информацию и замечать детали. Сейчас учёные исследуют природные альтернативы синтетическим вариантам. И хотя однозначных доказательств эффективности натуральных ноотропов наука пока не получила, перспективы точно есть.

1. Кофеин

Кофе и чай пьют, чтобы проснуться, взбодриться и сосредоточиться. Содержащийся в них кофеин действительно оказывает стимулирующее воздействие на психику. Он блокирует аденозиновые рецепторы в мозге и таким образом снижает концентрацию аденозина — вещества, которое накапливается при усталости и вызывает желание поспать.

Кроме этого, учёные обнаружили следующие эффекты от употребления кофеина:

  • улучшаются внимание и наблюдательность;
  • возрастает скорость реакций;
  • повышается производительность;
  • память и способность быстро принимать решения становятся чуть лучше.

Чтобы получить эти бонусы, надо выпить от 40 до 300 мг кофеина. Для сравнения: в одной чашке (237 мл) свежесваренного натурального кофе содержится 96 мг кофеина, а в чашке чёрного чая — почти 50.

2. L-тианин

Эта аминокислота есть в чае — и чёрном, и зелёном. 200 мг L-тианина достаточно, чтобы человек почувствовал себя спокойно, расслабленно и одновременно очень сосредоточенно. А приём всего 50 мг L-тианина значительно усиливает альфа-ритмы в мозге — как полагают учёные, такая электрическая активность тесно связана с творчеством.

L-тианин хорошо работает в связке с кофеином, смягчая его негативные эффекты, например нервозность.

Когда мы пьём чай, то не ощущаем яркого эффекта из-за малой дозировки: в одной чашке содержится всего около 20 мг. Концентрированный L-тианин в виде биодобавки можно купить в аптеке, но перед началом курса стоит проконсультироваться с терапевтом.

3. Глицин

Эту аминокислоту мы получаем из пищи с высоким содержанием белка: мяса, рыбы, яиц, кисломолочных продуктов, бобовых. Но организм может производить глицин и самостоятельно на основе других химических веществ.

Глицин необходим для выработки коллагена — белка, из которого строятся кожа, мышцы, кости. Также аминокислота активно участвует в обмене веществ, регулирует работу сердца и иммунитета. А ещё влияет на деятельность мозга. По некоторым данным, глицин улучшает память и помогает более сосредоточенно и эффективно работать с информацией при усталости.

В обычном ежедневном меню содержится до 2 г этой аминокислоты. Чтобы получить ноотропный эффект, дозу можно увеличить с помощью аптечных биодобавок (только не забудьте узнать мнение врача).

Однако учтите, что эффект в любом случае будет незначительным, а доза, при которой вы действительно сможете заметить улучшения памяти или производительности, вообще ещё не определена.

4. Индийский щитолистник (брахми)

Это растение содержит активные соединения бакозиды, которые защищают мозг от окислительного стресса и улучшают передачу сигналов в гиппокампе — области, обрабатывающей воспоминания.

Кроме того, некоторые исследования показывают, что растительный экстракт щитолистника, возможно, помогает быстрее обрабатывать информацию и улучшает скорость реакций.

Ключевое слово тут — «возможно»: исследований пока всё-таки маловато. Поэтому никаких рекомендаций с конкретными дозами и длительностью применения медицина не даёт. Но попробовать эффект индийского щитолистника в виде биодобавок не возбраняется.

5. Гингко билоба

Биодобавки с экстрактом листьев дерева гингко билоба, если принимать их не менее шести недель, улучшают память и когнитивные способности у здоровых людей среднего и пожилого возраста. Это подтверждают сразу несколько исследований.

Кроме того, есть данные, что приём гингко билоба перед выполнением какой-либо сложной задачи, умственной или физической, помогает ощутимо снизить уровень стресса и кровяного давления.

Однако, как и в случае с брахми, не все исследования подтверждают ноотропные свойства гингко, и доказательная медицина пока смотрит на растение с сомнением.

6. Женьшень

Женьшень — это действительно перспективный ноотроп. Так, несколько небольших исследований продемонстрировали, что однократный приём 200–400 мг порошка из корня женьшеня помогает людям быстрее и точнее решать математические задачи.

Однако долгосрочные наблюдения показывают, что организм со временем привыкает к женьшеню, и положительные ноотропные эффекты продукта сходят на нет. Всё это требует дальнейшего изучения.

7. Родиола розовая

Растение с этим красивым названием — известный адаптоген, который помогает организму справляться со стрессом. Биодобавки с родиолой повышают настроение и уменьшают симптомы эмоционального выгорания.

Вдобавок учёные выяснили, что ежедневный приём небольших доз родиолы улучшает самочувствие и снижает умственную усталость у студентов, которые сдают сложные экзамены.

Однако точная «работающая» доза родиолы пока не установлена. Исследования продолжаются.

8. Готу кола

Готу кола, или центелла азиатская, — растение, распространённое в тропических странах. В нём содержатся вещества, которые стимулируют выброс ацетилхолина. Этот нейромедиатор управляет скоростью передачи сигналов в мозге. И, возможно, положительно влияет на умственные способности.

Так, учёные провели небольшое исследование, чтобы узнать, смогут ли экстракт готу колы и фолиевая кислота улучшить функции мозга у людей, переживших инсульт. Оба средства оказались одинаково эффективными. Но экстракт готу колы в количестве от 750 до 1 000 мг лучше справился с восстановлением памяти.

В другом эксперименте оценивалось, как водный экстракт готу колы влияет на умственные способности мышей. Грызуны действительно начали лучше учиться и запоминать информацию, а ещё быстрее преодолевали устроенные для них лабиринты. Причём чем старше была мышь, тем очевиднее становился эффект.

Конечно, с точки зрения доказательной медицины крохотные эксперименты на животных убедительным доказательством не назовёшь. Но потенциал у растения есть.

9. Левзея

Её любят спортсмены: у экстракта этого растения выраженный тонизирующий эффект, который уменьшает усталость и даёт ощущение прилива энергии.

Исследований о том, как левзея влияет на мозг, крайне мало. Но в одном эксперименте на крысах учёные обнаружили, что экстракт растения улучшает память и способность к обучению.

Правда, у специалистов были сложности с дозировкой. В малых количествах левзея не оказывала никакого эффекта. В больших вообще делала крыс менее обучаемыми. Так что количество экстракта левзеи нужно тщательно подбирать. Однако пока ни для крыс, ни тем более для людей эффективную дозировку ещё не просчитали.

Эта статья была опубликована 13 марта 2017 года. В ноябре 2021-го мы обновили текст.

Читайте также 🧠🌿

что лучше и в чем разница (отличие составов, отзывы врачей)

Хроническая усталость, ежедневный стресс, бессонница — постоянные спутники человека. Чтобы избавиться от этих проблем и предотвратить их появление, часто используют различные медикаментозные средства. В их число входят такие препараты, как Глицин и Биотредин.

Глицин и Биотредин помогают от хронической усталости, ежедневных стрессов, бессонницы.

Характеристика препаратов

Оба препарата относятся к одной фармакологической группе и обладают рядом похожих по воздействию свойств.

Глицин

Препарат Глицин (латинское название — Glycinum) относится к ноотропным и седативным средствам, благоприятно влияющим на деятельность головного мозга и центральной нервной системы.

Он эффективен при следующих заболеваниях:

  • хроническая бессонница;
  • невротическое и тревожное состояние;
  • врожденная или приобретенная энцефалопатия;
  • хронический алкоголизм;
  • апатия, угнетенное состояние, депрессия;
  • абстинентный синдром;
  • стресс, состояние шока после перенесенных нервных потрясений;
  • хроническая усталость;
  • метаболический синдром;
  • ситуативная раздражительность, озлобление, немотивированная агрессия;
  • эмоциональная лабильность;
  • снижение работоспособности.

Считается, что эта аминокислота оказывает положительное влияние на организм при комплексной терапии вегетососудистой дистонии.

Глицин быстро проникает в жидкости и ткани, не оказывает токсического воздействия на организм. Эта аминокислота нормализует процессы возбуждения и торможения в центральной нервной системе, благотворно влияет на умственную активность и работоспособность, снижает содержание вредных веществ, в том числе продуктов распада алкоголя после приема большого количества спиртосодержащих напитков.

Биотредин

Биотредин (латинское название — Biotredin) — препарат, разработанный российскими учеными. Действующие вещества средства: L-треонин и пиридоксина гидрохлорид (витамин В6).

Благодаря составу препарат способствует улучшению работоспособности мозга, а также помогает организму справиться с последствиями злоупотребления алкоголем. Средство способствует снижению психоэмоциональной нагрузки на организм человека, улучшает работоспособность, благотворно влияет на мозговую деятельность.

Препарат часто назначают в период купирования абстинентного синдрома, поскольку в процессе распада треонина происходит выделение глицина и ацетальдегида, стимулирующих синтез АТФ в тканях организма. Таким образом, показаниями для применения Биотредина являются:

  • хроническая или ситуативная агрессия;
  • плохое настроение;
  • абстинентный синдром;
  • низкая работоспособность, в том числе у детей и подростков;
  • лечение хронического алкоголизма в составе комплексной терапии.

Считается, что если назначать Биотредин детям, то у них повышается успеваемость в школе, улучшается настроение, снижается уровень конфликтности с родителями и учителями.

В чем отличие и что общего у Глицина и Биотредина

Несмотря на то что и Глицин, и Биотредин относятся к одной фармакологической группе — ноотропы, между ними существуют некоторые различия.

Прежде всего они имеют различный химический состав. Среди специалистов есть мнение, что Биотредин лучше назначать при склонности к депрессивным состояниям, апатии, эффективен он и при лечении и профилактике алкоголизма и абстинентного синдрома.

Глицин чаще всего применяют в случаях, когда требуется повысить настроение, усилить работоспособность и ускорить деятельность мозга. Этот препарат особенно эффективно принимать в период повышенных психоэмоциональных нагрузок.

Препараты сходны в том, что обладают похожими свойствами: оба положительно воздействуют на деятельность мозга и центральной нервной системы, способствуют усилению кровообращения и усвоению кислорода организмом, повышают иммунитет и устойчивость к стрессу. Совместный прием способствует:

  • комплексному положительному воздействию на деятельность головного мозга и центральной нервной системы;
  • снижению напряжения в психоэмоциональной сфере;
  • улучшению и стабильности настроения;
  • улучшению памяти, внимания, внимательности;
  • снижению токсического воздействия на организм при чрезмерном употреблении алкогольных напитков.

В число плюсов для обоих препаратов входит и тот факт, что они не токсичны для организма, быстро усваиваются и оказывают терапевтический эффект. Благодаря этим свойствам и Глицин, и Биотредин можно назначать даже маленьким детям, беременным женщинам, пожилым людям.

Что лучше: Биотредин или Глицин

Медики считают, что эти препараты не являются взаимозаменяемыми, несмотря на идентичность фармакологических свойств.

У специалистов нет однозначного мнения о том, какой из этих препаратов лучше. Тот или иной назначают в зависимости от симптоматики заболевания и ожидаемых результатов лечения.

Однако считается, что если одновременно принимать оба препарата, они оказывают комплексное воздействие на нервную систему человека.

Доказано, что употребление и того, и другого препарата безопасно при беременности, при этом лечебные свойства медикаментов оказывают положительное действие как на организм будущей матери, так и на плод.

С осторожностью нужно применять оба препарата при нарушении функции почек.

С осторожностью нужно применять оба препарата при нарушении функции почек.

Рекомендуется принимать эти медикаменты совместно для профилактики возникновения различных психоэмоциональных нарушений.

Отзывы врачей

Антон, врач-невролог, Москва: «Пациентам с выраженным неврозом, ситуативной агрессивностью, с перепадами настроения рекомендую принимать Глицин вместе с Биотредином по такой схеме: 3 раза в день не менее 1 месяца. В большинстве случаев за это время наступает улучшение состояния. Однако людям с хронической лабильностью психики рекомендую подобный курс несколько раз в год».

Анастасия, врач-психотрапевт, Краснодар: «Глицин и Биотредин входят в число лучших препаратов, которые можно назначать пациентам с психофизиологическими расстройствами. Средства мягко воздействуют на организм, быстро оказывают терапевтический эффект, не возбраняется их длительное применение».

Алла, врач-нарколог, Хабаровск: «Многим пациентам знаком похмельный синдром, особенно после нескольких дней злоупотребления спиртным. Всегда рекомендую таким людям Биотредин, это средство способствует выводу продуктов распада алкоголя из организма и помогает быстрее восстановиться в период выхода из запоя и в период ремиссии».

Отзывы пациентов о препаратах Глицин и Биотредин

Анна, 48 лет, Саратов: «Страдаю хронической бессонницей, уже и к врачам обращалась, и принимала кучу лекарств. Недавно прочитала, что есть такой препарат — Глицин. В аптеке увидела, что он недорогой, купила. Приняла таблетку под язык на ночь и утром удивилась, что так быстро заснула и спала спокойно всю ночь. Заметила, что при постоянном приеме средства стала гораздо спокойнее, с оптимизмом отношусь ко всем превратностям жизни».

Антон, 30 лет, Иркутск: «Так случилось, что в сложный период жизни стал часто сильно выпивать, а наутро мучался с сильным похмельем. Знакомый врач посоветовал принимать в этом случае препараты Глицин, Биотредин и витамин В 6. Купил их в аптеке за копейки и употребляю наутро после приема алкоголя, стал чувствовать себя лучше. Через несколько дней, в течение которых принимал эти препараты, успокоился, стал проще смотреть на жизнь, и потребность в алкоголе отпала».

Татьяна, 27 лет, Верхний Уфалей: «Во время второй беременности сильно нервничала, из-за этого портились отношения с близкими. В очереди на консультацию к гинекологу познакомилась с женщиной гораздо старше себя, разговорились, она узнала о моих проблемах и посоветовала принимать седативные средства, в частности Глицин. Сказала. что он не повредит будущему ребенку. Последовала совету, через несколько дней заметила, что стала гораздо спокойнее, хорошо сплю, да и отношения с родными вошли в нормальное русло».

Лучшие натуральные ноотропы и адаптогены

Современная фармакологическая промышленность предлагает широкий спектр препаратов для решения разных проблем, но не всегда их прием проходит без последствий. К примеру, многие химически синтезированные адаптогены и ноотропы могут вызывать побочные эффекты и имеют ряд противопоказаний. Если необходимо использование препаратов этих фармакологических групп, лучше обратить внимание на добавки натурального происхождения.

Что такое адаптогены и их роль в организме


Натуральные адаптогены — биодобавки растительного происхождения, призванные укреплять неспецифический иммунитет. Человек, принимающий такие БАДы, лучше противостоит болезнетворным вирусам и бактериям, а при заражении респираторными заболеваниями быстрее выздоравливает. Также адаптогены используются для борьбы с затяжным стрессом и устранении его негативных последствий. 

Особенности и преимущества адаптогенов натурального происхождения:

  • экологически чистый состав;
  • высокая биодоступность;
  • безвредность для организма;
  • возможность принимать в любом возрасте и при наличии хронических патологий.

Адаптогены называют общетонизирующими препаратами. Они влияют одновременно на все системы органов, улучшают нервную и эндокринную регуляцию, повышают интенсивность метаболизма, запускают регенерацию. Предполагается, что их положительное влияние связано с воздействием на ферментативную активность и синтез РНК.

Лучшие натуральные адаптогены

С целью улучшения работы всего организма, укрепления иммунитета и борьбы со стрессом используются адаптогены с разным составом. Лучшими считаются натуральные природные препараты.

  1. Женьшень. Это универсальное растение, которое способствует восстановлению после болезней. Оно помогает контролировать эмоции, улучшает память, нормализует работу сердца и укрепляет сосуды. Женьшень используется как природное средство для похудения и омоложения. 
  2. Элеутерококк. Растение, признанное официальной медициной. Оно стимулирует умственную деятельность и насыщает энергией. Регулярный прием добавок на основе элеутерококка — залог крепкого иммунитета, нормального уровня сахара в крови, стабильного давления. 
  3. Ашвагандха. Аюрведическая добавка на основе физалиса. Средство повышает неспецифический иммунитет, помогает бороться с вирусами и бактериями. Оно принесет пользу при бессоннице и эмоциональном перенапряжении.
  4. Мумие. Дарит не только здоровье, но и красоту. Помогает справиться с целлюлитом, растяжками. Оздоравливает организм в целом, благотворно влияет на работу сердечно-сосудистой системы, укрепляет костную ткань, насыщает минералами, помогает при болезнях ЖКТ. 
  5. Гриб рейши. Добавка признана традиционной китайской медициной. Она обладает адаптогенным действием, а также нормализует давление, выводит токсины, снижает уровень сахара, защищает от образования тромбов в кровеносном русле. 
  6. Кордицепс. Грибной мицелий работает как мощный иммуномодулятор. Добавка действует комплексно, не просто повышая защитные силы, а активизируя кроветворение и омолаживая организм. Мужчины оценят благотворное влияние кордицепса на эректильную функцию.
  7. Мака. Природный адаптоген со свойствами афродизиака. Добавка оказывает общеукрепляющее и тонизирующее действие, а также повышает либидо, поддерживает сексуальную энергию. Средство улучшает обменные процессы и борется с апатией. 
  8. Маточное молочко. Добавка необходима людям, подвергающимся повышенным физическим и умственным нагрузкам. Она повышает работоспособность, укрепляет иммунитет, улучшает общее самочувствие. Доказано, что маточное молочко снижает артериальное давление, очищает печень от токсинов и способствует ее регенерации. 

Ценность ноотропов и показания к их использованию

Ноотропы входят в группу психотропных препаратов — медикаментов, регулирующих работу центральной нервной системы. Нейрометаболические стимуляторы способствуют:

  • поддержке умственной деятельности;
  • укреплению памяти;
  • повышению концентрации внимания;
  • стимуляции познавательных функций.

Многие ноотропы обладают широким спектром действия. Они не только влияют на головной мозг, но и оказывают седативный и миорелаксантный эффект. Препараты воздействуют напрямую на нейроны и связи между ними, а также улучшают мозговое кровоснабжение. 

Ноотропы назначаются при:

  • возрастных изменениях;
  • дефиците внимания у детей;
  • снижении работоспособности у взрослых;
  • депрессивных состояниях.

Лучшие ноотропы

Ноотропные препараты синтетического происхождения назначаются строго по показаниям и отпускаются только по рецепту врача, так как их прием чреват побочными эффектами, а самостоятельное изменение схемы использования может привести к исчезновению положительного эффекта от лечения или, напротив, передозировке медикаментом. Ноотропы растительного происхождения действуют мягко. Они безопасны для детей, взрослых и пожилых людей.

  1. Витамин B12. Один из важнейших элементов своей группы. Соединение поддерживает функционирование ЦНС. Оно улучшает память и обеспечивает высокую концентрацию внимания. Цианокобаламин регулирует белковый обмен и защищает от анемии. 
  2. Кофеин. Является мощнейшим природным стимулятором. Повышает выносливость, насыщает энергией, снижает риск болезни Альцгеймера, борется с сонливостью и улучшает обмен веществ. Может вызывать привыкание, поэтому необходимо делать перерыв между курсами.
  3. L-карнитин. Это незаменимая аминокислота, обеспечивающая организм энергией. Препарат повышает выносливость, улучшает работу сердца, а также способствует сжиганию жировой прослойки. Добавка необходима всем, кто активно тренируется. 
  4. L-фенилаланин. Аминокислота, которая регулирует работу эндокринной системы, улучшает настроение, помогает справиться с депрессией. Вещество снимает тревожность и повышает способности к обучению.
  5. L-тирозин. Назначается для повышения усидчивости, снятия раздражительности. Добавка повышает работоспособность, защищает от профессионального выгорания, борется с апатией. Она будет полезна женщинам, страдающим от ПМС. 
  6. Глицин. Вещество, необходимое для течения метаболических процессов в организме. Аминокислота участвует в синтезе белков, выработке желчи, передаче генетической информации. Глицин действует как успокаивающий нейромедиатор. Он повышает умственную активность, снимает тревожность, помогает уснуть. 
  7. Готу Кола. Растительный препарат богат витаминами и минералами, обеспечивающими широкий спектр действия. Добавка улучшает память и концентрацию внимания, а еще укрепляет иммунную защиту и нейтрализует токсины.
  8. MindBooster. Ноотропный комплекс, который состоит из 10 органических компонентов (Витамин B12, L-Тирозин, Кофеин, Родиола Розовая и многое другое). Комплекс повышает работоспособность и концентрацию внимания, улучшает память.

Ноотропы и адаптогены синтетического происхождения чаще всего выполняют лишь одну функцию — улучшение работы ЦНС и тонизирование организма. Средства природного происхождения не уступают по эффективности и работают комплексно, решая сразу несколько проблем. Кроме того, они имеют меньше ограничений и не вызывают побочных эффектов. 

ЦЕРЕБРОЛИЗИН или ГЛИЦИН ФОРТЕ 💊 что лучше

ЦЕРЕБРОЛИЗИН

ГЛИЦИН ФОРТЕ

ЦЕРЕБРОЛИЗИН


Имя: Корнякова Светлана
Отзыв: Да что тут и говорить не надо ничего, это супер классное лекарство, мне кажется его всем можно ставить и больным и здоровым. Память, реакция, да вообще с первого укола в вену жизнь налаживается и все делаешь и соображаешь быстрее всех. Так кажется, что это чувствуют окружающие, имеется ввиду твое преимущество над ними.


Имя: ёж
Отзыв: препарат отличный!!!!!


Имя: татьяна генералова
Отзыв: нам 10мес.были у невролога,ей непонравилось что ребёнок невстаёт на полную ногу,назначила цереброзилин. а я вот боюсь както лишний разколоть ребёнку какие то препораты.может кто подскажет есть ли необходимость в этом ЦЕРЕБРОЛИЗИНЕ.


Имя: T [email protected]
Отзыв: нам 10мес.были у невролога,ей непонравилось что ребёнок невстаёт на полную ногу,назначила цереброзилин. а я вот боюсь както лишний разколоть ребёнку какие то препораты.может кто подскажет есть ли необходимость в этом ЦЕРЕБРОЛИЗИНЕ.


Имя: Юра Троянов
Отзыв: Лекарство действительно хорошее! Я почувствовал себя полноценным человеком, буквально после второго укола!!


Имя: Алексей Чирков
Отзыв: Ребёнку три месяца,назначили Церебролизин стоит колоть или нет.


Имя: Наталья Павлова
Отзыв: У ребенка раннего возраста до 4-5 лет может резвиться косоглазие


Имя: Ирина Кухарчик
Отзыв: скажите пожалуйста, есть ли у детей нам 1 год побочные реакции на этот препарат. я прочитала девушка пишет про косоглазие, что-то страшно??


Имя: Аня Кабдрахиева
Отзыв: лекарствоРебёнку три месяца,назначили Церебролизин стоит колоть или нет.


Имя: Марат Мавлянов
Отзыв: моей жене врач посоветовал при климаксе принимать 1 мл в день и так 30 дней.а мы тут прочитали что это от другово!Кому верить?Посоветуйте!!!


Имя: Евгения
Отзыв: у меня после операции памяти совсем не стало!не подскажете в каких дозах его колоть нужно??


Имя: Светлана Ковалевская
Отзыв: Этот препарат не вводят при эпилепсии(когда бы этот приступ не произошел-хоть 20 лет назад).Читайте внимательно аннотацию!


Имя: игорь анненков
Отзыв: стоит ли пройти курс лечения церебролизина при атксии мозжечка


Имя: Надежда Вероника
Отзыв: Я колола Церебролизин в/в № 10, по 10 мл, в связи с ЧМТ, на протяжении многих лет, 1 раз в году. После последнего применения — прожила неделю, далее начался ад!!!! состояние резко ухудшилось, и уже 6 месяцев мне ничем помочь не могут, была парализация 2х сторонняя( 2 ноги, 2 руки, лицо), спасли, но общее состояние ( голова) совсем плохо. Невролог не может уже ничего посоветовать, ищу в нете сама, и советуюсь с ним.


Имя: yyywoman
Отзыв: У отчима случился инсульт и ему назначили курс ноотропов. Врач сказал купить или церебролизин или целлекс. Может кто-то подсказать, что лучше из этого купить?


Имя: Нирида Ставрополева
Отзыв: У отчима случился инсульт и ему назначили курс ноотропов. Врач сказал купить или церебролизин или целлекс. Может кто-то подсказать, что лучше из этого купить?


Имя: Ольга Дацева
Отзыв: У отчима случился инсульт и ему назначили курс ноотропов. Врач сказал купить или церебролизин или целлекс. Может кто-то подсказать, что лучше из этого купить?


Имя: yyywoman
Отзыв: А в чем собственно разница между церебролизином и целлексом? ведь оба препарата-это ноотропы, которые влияют на работу головного мозга…


Имя: Ольга Дацева
Отзыв: Да, оба они ноотропы. И оба работают. Но.. как бы это сказать… целлекс-это новый современный препарат, а церебролизин, мягко говоря устаревший.


Имя: Арыстан Балталы
Отзыв: помогает ли этот препарат после алкогольной интоксикации


Имя: Еликонида Устинова
Отзыв: Мне кажется — если бы церебролизин был в таблетках — его бы популярность была в разы выше. Уколы менее приятны, но более эффективны конечно. Мне помогли при сильнейших головных болях.


Имя: Полимерка Икатова
Отзыв: Мама живёт с деменцией четвёртый год. Изначально ставили уколы по 10 мл, сейчас дозировка увеличилась до 20 мл. Конечно, от забывчивости не помогает, но можем оставлять маму одну дома, не переживая, что что то случиться.


Имя: Елизавета Грецкая
Отзыв: Церебролизин назначили маме после инсульта — эффект слабый. Речь и координация движений начали заметно восстанавливаться после уколов кортексина.


Имя: Оксана Крутова
Отзыв: Для ликвидаций последствий инсульта маме прописали церебролизин. Я заметила, что уколы вызывают головокружение, бессонницу, одышку. Врач поменял препарат на другой ноотроп – кортексин. Пока не вижу побочных действий. Небольшие улучшения есть, но врач советует проколоть кортексин повторно, через 3 месяца.


Имя: Веренея Париловкина
Отзыв: У мужа была травма затылочной части головы. В последствии мучался от сильных головокружений. Пока один невропалог не назначил Церебролизин. Проставил его внутривенно (доза была 10 мл за раз) и забыл о своем недуге. Правда не в начале лечения это случилось, а после завершения.


Имя: Елена Гришаева
Отзыв: Попала в аварию ( занесло на скользкой дороге), результат: разбитая машина и сильная травма головы. В больнице быстро поставили на ноги. Ставили как раз внутривенно церебролизин вначале по 20 мл, а потом курсом по 10 мл. Через 2 недели уже дома была. Ничего не беспокоит по сей день.


Имя: Анастасия Малинина
Отзыв: Нам врач в областной назначил все то же самое, но вместо церебролизина– кортексин, по его словам он больше подходит деткам и в нашем случае особенно. Я довольна эффектом: сын стал внимательнее, спокойнее, играет сам с собой, не орет постоянно, а только, когда голодный, результат лечения однозначно есть.


Имя: Милана Байлиева
Отзыв: У моей любимой мамы Альцгеймер. Из выписанных препаратов, только церебролизин тормозит развитие болезни. Уже 2 года состояние не ухудшается. И какихлтбо побочных эффектов у нее не вызывал.


Имя: Ebony Cooper
Отзыв: «Посчастливилось» получить травму головы серьезную. Лечение проходила церебролизином. Препарат не особо дорогой, но очень действенный. Проставила 2 курса. Первый длился 20 дней по 10 мл, второй с такой же дозировкой, но уже 10 дней. Побочных нет. Самочувствие после лечения замечательное.


Имя: Люба Величко
Отзыв: кто слышал ,что церебролизин делают в голову(за ушами и в обл затылка)знакомая говорит что ей врач делает именно так?

ГЛИЦИН ФОРТЕ


Имя: Вера Келинa
Отзыв: помимо того что заметно улучшилась работа мозга, чувствую прилив сил и бодрости, думаю, именно благодаря глицину, оч хорошее дополнение для тех, кто много работает.


Имя: Василий Тихонов
Отзыв: Стал очень агрессивным после глицина.


Имя: Destroyer
Отзыв: противоречивые отзывы, однако)


Имя: tatyana frattini
Отзыв: ОТЛИЧНЫЙ ПРЕПАРАТ ! Мне он очень помог в сложной ситуации. Ломаю голову над тем, где его купить во Франции или в Германии. Если кто-то знает -посоветуйте, пожалуйста.


Имя: оля меркушанова
Отзыв: ВЛИЯЕТ ЛИ НА ЖЕЛУДОК ВЫЗЫВАЕТ ЛИ ИЗЖОГУ


Имя: lera.butkovets
Отзыв: Никогда не помогал обычное плацебо.


Имя: vukvestnik vukvestnik
Отзыв: Хороший препарат


Имя: Olga Zin
Отзыв: хороший препарат


Имя: Дмитрий Шестаков
Отзыв: Малышу 6 месяцев. Начали пить глицин. Сразу после приёма от трёт нос и глаза. Высыпаний вроде нет. Это нормально? Продолжать пить?


Имя: OLGA_TIM
Отзыв: Попала в нервную ситуацию, два дня не могла успокоится, колбасило и было реально плохо!’вспомнила что дома есть глицин форте, зачем-то купила неск мес назад. Выпила 2 табл — все ушло! Решила пропить месячный курс, тем более он содержит витамины группы В, что оооочень полезно для нервной системы!


Имя: Lini Svet
Отзыв: мне препарат отлично помогает во время сессий, именно глицин форте где 500 мг….мозг сразу включается))


Имя: Lini Svet
Отзыв: мне препарат отлично помогает во время сессий, именно глицин форте где 500 мг….мозг сразу включается)


Имя: Светлана Павлова
Отзыв: как глицин снижает давление, если ноопепт (дорогой аналог глицина) написано,что повышает давление, а в инструкции глицина этого не пишут.


Имя: Мария Ткаченко
Отзыв: Жалко что в Глицин нельзя гипотоникам, приходится спасаться Валокордином, но его часто пить нельзя так как он может вызвать привыкание. Зато очень сильный препарат успокаивает на раз-два.


Имя: Лориэна
Отзыв: Мне показалось, что успокоительное действие у него весьма слабое. Я конечно и не ждала, что он будет помогать как валокордин, но тут вообще нервы в порядок не пришли, раздражительность никуда не делась.


Имя: svetlik
Отзыв: а мне эти таблетки прекрасно помогают, эффект тот же самый что от дорогих аналогов. перед тем как что-то купить всегда аналоги препаратов ищу, которые мне советуют, так и нашла глицин форте)


Имя: Наталья Шац
Отзыв: Мне показалось, что успокоительное действие у него весьма слабое. Я конечно и не ждала, что он будет помогать как валокордин, но тут вообще нервы в порядок не пришли, раздражительность никуда не делась.


Имя: Alina Alina
Отзыв: Пью сама и сестра тоже. Хорошо работает для обеих — улучшается сон, работа умственная проще дается (проще запомнить информацию и переработать её тоже), настроение более стабильным становится. Нравится мне этот глицин, буду использовать еще


Имя: Илья Арсеньев
Отзыв: С началом учебной деятельности в универе Глицин Форте покупала мама, перед каждой сессией постоянно мандраж, ничего в памяти не укладывалось. Сейчас уже сам покупаю перед сессией. Успокаивает, напряженность снимает, и память получше стала.


Имя: Ким Кардашьян
Отзыв: Долго искала свое успокоительное, такое чтоб всегда под рукой. Глицин Форте от Эвалар в этом плане подошел идеально, до этого пила обычные таблетки Валерьяны, но от них ходила вся как пьяная, хотелось просто спать и все. С глицином Форте такого нет, могу хоть за руль сесть.


Сравнение цен на ЦЕРЕБРОЛИЗИН и ГЛИЦИН ФОРТЕ

💡 Если вы не нашли ответ на интересующий вас вопрос в сравненительных отзывах о препаратах ЦЕРЕБРОЛИЗИН или ГЛИЦИН ФОРТЕ, то обязательно посмотрите отзывы о аналогичных лекарственных препаратах, сравнения ЦЕРЕБРОЛИЗИН и ГЛИЦИН ФОРТЕ с другими похожими по действию лекарствамии и инструкции по применению, представленные ниже. Возможно вы найдете для себя препарат лучше чем ГЛИЦИН ФОРТЕ или ЦЕРЕБРОЛИЗИН.

⚠️ Информация представлена в ознакомительных целях и не должна являться основанием для принятия решения о целесообразности приема ЦЕРЕБРОЛИЗИН или ГЛИЦИН ФОРТЕ. Не занимайтесь самолечением! Перед применением препарата ГЛИЦИН ФОРТЕ или ЦЕРЕБРОЛИЗИН обязательно проконсультируйтесь с врачом!


Инструкции по применению препаратов ЦЕРЕБРОЛИЗИН и ГЛИЦИН ФОРТЕ и сравнение с другими аналогичными лекарствами

Сравнительная характеристика — афобазол или глицин, что лучше принимать

Содержание данной статьи кратко расскажет про два известных лекарственных средства. Целью будет узнать, о каждом препарате и решить: афобазол или глицин, что лучше подходит под одинаковые симптомы и в чем их различие.

Так же можно ли принимать их вместе и какова их совместимость.

Характеристики глицина

Глицин – синтезированная аминокислота, которую можно принимать в качестве дополнения. Он может использоваться для лечения, шизофрении, тревоги (нервозности), бессонницы (проблемы со сном), гипогликемии (низкий уровень сахара в крови) и подагры. Это может также уменьшить мышечные спазмы, симптомы доброкачественной гиперплазии предстательной железы (ДГПЖ) и повысить иммунную систему.
Показания:

  • Лечение шизофрении при использовании с другими обычными лекарствами.
  • Лечение наиболее распространенной формы инсульта (ишемический инсульт). Помещение глицина под язык может помочь ограничить повреждение головного мозга, вызванное ишемическим инсультом, если оно началось в течение 6 часов после инсульта. Ишемический сток вызван закупоркой кровеносного сосуда (обычно сгустком) в головном мозге. Мозговые клетки за пределами препятствия не получают кислорода и начинают умирать, что наносит непоправимый вред.
  • При расстройствах сна.
  • При снижении умственной работоспособности при стрессовых ситуациях и психоэмоциональном напряжении.

к содержанию ↑

Характеристики Афобазола

Афобазол  являет собой анксиолитическое средство, которое обеспечивает анти-тревожное и активирующее действие. Он был разработан для лечения, нарушений сна, неврастении, предменструального синдрома, расстройств адаптации, выведения алкоголя из организма. Имея такие потенциальные эффекты, афобазол, с другой стороны, не ингибирует ЦНС, не обладает гипоседативной и мышечной релаксантной активностью, не сопровождается сонливостью, отрицательным эффектом на удержание и консолидацию памяти.

Показания:

  • Тревожные расстройства: плохие чувства, напряженность в теле, раздражительность, слезливость, страх и т. д.
  • Различные соматические (психофизиологические) расстройства, например, астма, синдром раздраженной толстой кишки, системная красная волчанка, ишемические болезни сердца и т. д.
  • Нарушения сна из-за беспокойства и стресса
  • Выделение алкоголя и никотина.

к содержанию ↑

Что лучше?

Таблица ниже, указывает на общие основные характеристики.

Глицин Афобазол
Прием перед сном в течение 2-4 дней, улучшает качество сна. Снижает тревожность, и соответственно помогает с нарушениями сна.
Улучшение работы памяти. Не имеет негативного влияния на качество памяти.
Защита печени от вредного воздействия алкоголя Выводит алкоголь и никотин.
Противопоказания: Индивидуальная непереносимость препарата и ограничение возраста до трех лет. Противопоказания: В период беременности и кормления грудью прием препарата противопоказан.
Не вызывает физиологической зависимости. Отсутствует возникновения физической зависимости.

Как видно из вышеуказанной таблицы, оба лекарственных средства  сходны по некоторым параметрам воздействия.

Кроме этого есть различия:

Глицин Афобазол
Глицин снижает токсичность антиконвульсантов, антипсихотических средств, антидепрессантов, а так же противосудорожных средств. В сочетании со снотворными препаратами и транквилизаторами усиливается эффект торможения ЦНС. Вызывает усиление анксиолитического действия диазепама.

Потенцирует противосудорожный эффект карбамазепина.

Для стабильного результата, в виду слабого воздействия, необходимо принимать регулярно и в увеличенной дозировке. Принимается во время стресса, для снятия тревожности и эмоциональной перегрузки.
Аминокислота, повышающая умственные способности. Химический препарат, воздействующий на ЦНС, показан при хронических или острых для психики ситуаций.

Глицин, кладется под язык и рассасывается.

Афобазол, запивается небольшим количеством воды.

к содержанию ↑

Совместимость препаратов

Глицин является аминокислотой, а значит легко взаимодействует с другими веществами, не вызывая побочных эффектов.

Совместно с Афобазолом, может использоваться как комплекс, взаимно дополняемых лекарственных препаратов. Их рекомендуется принимать с разницей 30 минут.

Совместно Глицин и Афобазол, способны помочь людям страдающим приступами паники, тревожными расстройствами и постоянным стрессом.

Но употребление алкоголя, во время совместного принятия этих двух препаратов, способно вызвать аллергические реакции, тошноте, тремору и головокружению.

Подводя итоги, определенное различие состоит в том, что Афобазол это химический препарат, который отлично справляется со своей задачей. Но в период беременности, предпочтительнее выбирать именно Глицин, так как хоть он гораздо слабее Афобазола, но является аминокислотой, которая естественна для головного мозга.

ГАМК и глицин — неврология

Большинство тормозных нейронов в головном и спинном мозге используют либо γ-аминомасляную кислоту (ГАМК), либо глицин в качестве нейротрансмиттера. Как и глутамат, ГАМК была обнаружена в тканях мозга в 1950-х годах, и вскоре после этого были проработаны детали ее синтеза и деградации. Дэвид Кертис и Джеффри Уоткинс несколько десятилетий назад первыми показали, что ГАМК подавляет способность нейронов млекопитающих запускать потенциалы действия. В настоящее время известно, что до одной трети синапсов в головном мозге используют ГАМК в качестве нейротрансмиттера.В отличие от глутамата, ГАМК не является важным метаболитом и не входит в состав белков. Таким образом, присутствие ГАМК в нейронах и окончаниях является хорошим начальным признаком того, что рассматриваемые клетки используют ГАМК в качестве нейротрансмиттера. ГАМК чаще всего обнаруживается в интернейронах локальной цепи, хотя клетки Пуркинье мозжечка представляют собой пример ГАМКергических проекционных нейронов (см. главу 19).

Преобладающим предшественником для синтеза ГАМК является глюкоза, которая метаболизируется до глутамата ферментами цикла трикарбоновых кислот, хотя пируват и глутамин также могут выступать в качестве предшественников.Фермент декарбоксилаза глутаминовой кислоты (GAD), которая обнаруживается почти исключительно в ГАМКергических нейронах, катализирует превращение глутамата в ГАМК (4). Для активности ГТР требуется кофактор пиридоксальфосфат. Поскольку пиридоксальфосфат получают из витамина B 6 , дефицит B 6 может привести к снижению синтеза ГАМК. Значение этого стало очевидным после того, как катастрофическая серия детских смертей была связана с отсутствием витамина B 6 в детских смесях.Отсутствие B 6 привело к значительному снижению содержания ГАМК в мозге, а последующая потеря синаптического торможения вызвала судороги, которые в некоторых случаях были фатальными.

Рисунок 6.10

Синтез, высвобождение и обратный захват тормозных нейротрансмиттеров ГАМК и глицина. (A) ГАМК синтезируется из глутамата ферментом декарбоксилазой глутаминовой кислоты, для чего требуется пиридоксальфосфат. (B) Глицин может быть синтезирован рядом (подробнее…)

Механизм удаления ГАМК подобен механизму удаления глутамата: и нейроны, и глия содержат высокоаффинные переносчики ГАМК.Большая часть ГАМК в конечном итоге превращается в сукцинат, который далее метаболизируется в цикле трикарбоновых кислот, который обеспечивает клеточный синтез АТФ. Ферменты, необходимые для этой деградации, ГАМК-аминотрансфераза и янтарный полуальдегиддегидрогеназа, оба являются митохондриальными ферментами. Ингибирование распада ГАМК вызывает повышение содержания ГАМК в тканях и усиление активности тормозных нейронов. Препараты, которые действуют как агонисты или модуляторы постсинаптических рецепторов ГАМК, такие как бензодиазепины и барбитураты, используются в клинической практике для лечения эпилепсии и являются эффективными седативными и анестезирующими средствами.

Распределение нейтральной аминокислоты глицина в центральной нервной системе более локализовано, чем у ГАМК. Около половины тормозных синапсов в спинном мозге используют глицин; большинство других тормозных синапсов используют ГАМК. Глицин синтезируется из серина митохондриальной изоформой серингидроксиметилтрансферазы. После высвобождения из пресинаптической клетки глицин быстро удаляется из синаптической щели с помощью специфических мембранных переносчиков. Мутации в генах, кодирующих некоторые из этих ферментов, приводят к гиперглицинемии, разрушительному неонатальному заболеванию, характеризующемуся вялостью, судорогами и умственной отсталостью.

TMG или DMG более эффективны?

 

TMG имеет три метильные группы, а DMG — две. Итак, чем больше, тем лучше, верно? Не обязательно; есть несколько различимых различий, которые следует учитывать.

Хотя TMG (триметилглицин) и DMG (диметилглицин) тесно связаны между собой, каждый из них служит разным целям и использует разные пути. Таким образом, может быть трудно определить, какой из них следует использовать в той или иной ситуации.

TMG и DMG являются пищевыми веществами, а не витаминами, поскольку ни у одного из них нет состояний, связанных с их дефицитом, однако дефицит этих доноров метила, вероятно, может способствовать возникновению проблем с возрастом.* Адекватные уровни как TMG, так и DMG играют жизненно важную роль в реакциях метилирования благодаря их свойствам донора метила.*

 

TMG и DMG используют разные пути

Как TMG, так и DMG являются неотъемлемыми частями одноуглеродного цикла, и оба они играют важную роль в путях метилирования. * Надлежащее метилирование необходимо для репликации и восстановления ДНК, производства энергии, иммунного ответа, поддержки стресса и рециркуляции глутатиона.* Глутатион (главный борец со свободными радикалами и детоксикант) имеет особое значение, так как без хорошо функционирующего метилирования организм не вырабатывает глутатион. 1  

TMG переносит свою метильную группу непосредственно на гомоцистеин, в то время как DMG использует путь фолиевой кислоты (метилфолата). Все работает вместе, как хорошо смазанный механизм, и в оптимальных условиях как TMG, так и DMG эффективно закачивают метильные группы в метиловый пул для производства SAM-e (S-аденозилметионина) из гомоцистеина.

Наличие двух путей для получения метильных групп в пуле похоже на отказоустойчивую систему. Тот факт, что они используют совершенно разные системы для пожертвований в метиловый пул, также означает, что TMG может лучше работать для одного человека, тогда как DMG лучше работает для другого.

 

Различные заряды влияют на эффективность абсорбции

TMG также является осмолитом , веществом, обладающим защитными свойствами и стабилизирующим белки. Поскольку DMG нейтрален, он легче проникает через гематоэнцефалический барьер.Другими словами, вы можете получить оба вещества в свою систему, но DMG переносится более эффективно, чем TMG. Тем не менее, дозировка играет ключевую роль, поэтому важно учитывать, как организм использует метаболит в зависимости от количества вырабатываемых метильных групп. Например, если вы сосредоточены на непосредственном количестве донорских метильных групп, принимая на ⅓ большую дозу DMG, вы получите то же количество донорских метильных групп, что и TMG. Итак, количество триметила по сравнению с диметилом — это еще не все.

Связанное содержание: НАСКОЛЬКО МЕТИЛИРОВАНИЕ ПОДДЕРЖКИ СЛИШКОМ СИЛЬНО?

DMG оказывает меньшее прямое влияние на гомоцистеин

И TMG, и DMG поддерживают здоровье сердечно-сосудистой системы за счет снижения уровня гомоцистеина, фактора риска сердечно-сосудистых заболеваний.* Те, у кого чувствительный уровень гомоцистеина или другие проблемы с гормонами, могут выбрать TMG, поскольку он отдает свои метильные группы непосредственно гомоцистеину. Однако способность DMG воздействовать на триглицериды может сделать его лучшим выбором для тех, у кого проблемы с холестерином.* 2

Поддержка детей с поведенческими проблемами*

Хотя TMG и DMG во многом различаются, оба эти вещества помогают изменить поведение детей с поведенческими проблемами; на самом деле, в одном исследовании они оказали почти одинаковое положительное влияние.* 3 Однако в том же исследовании было показано вдвое больше побочных эффектов при приеме ТМГ.

Предполагается, что метаболический состав некоторых детей с поведенческими проблемами может быть не в состоянии справиться с жестким метилированием, или, другими словами, слишком много сразу вбрасывать в путь метилирования. Для сравнения, DMG считается мягким метилатором, поскольку он проходит через фолиевую кислоту и B12.

 

Мы можем с уверенностью сказать, что и TMG, и DMG являются важными пищевыми добавками и успешно используются в ряде областей.Оба невероятно эффективно воздействуют на процесс метилирования.* Однако наличие дополнительной метильной группы не всегда является правильным ответом. Речь идет о выборе правильного вещества для вашей ситуации, чтобы поддерживать функции вашего тела, а также о соблюдении правильного режима питания и здорового образа жизни, чтобы в полной мере воспользоваться преимуществами.*

Роджер Кендалл, доктор философии

 

 

 

 

 

 

 

 

 

 

*Эти утверждения не были оценены Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов.Этот продукт не предназначен для диагностики, лечения, лечения или предотвращения каких-либо заболеваний.


Источники:

  1. «Метилирование ДНК у человека…», 2018 г. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6147084/. По состоянию на 26 сентября 2019 г.
  2.  «Недавние данные о N, N-диметилглицине (DMG): питательное вещество тысячелетия». https://www.vetriscience.com/white_papers/DMG_Townsend%20letter_2000.pdf. По состоянию на 29 сентября 2019 г.
  3.  «TMG против DMG.https://autismrecoverysystem.com/wp-content/uploads/2017/05/TMG-versus-DMG.pdf. По состоянию на 26 сентября 2019 г.

 

Сравнительное исследование «стерильной воды» и «глицина (1,5%)» в качестве ирригационной жидкости при трансуретральной резекции предстательной железы

Аннотация

Цели и задачи: Настоящее исследование было проведено с целью изучения и сравнения эффектов стерильной воды и глицина (1,5%) в качестве ирригационной жидкости при хирургии трансуретральной резекции простаты ( ТУРП).

Методы: T Это было проспективное рандомизированное двойное слепое исследование. В общей сложности 60 пациентов (возраст: 50-80 лет) I и II степени ASA с доброкачественной гиперплазией предстательной железы , направленных на трансуретральную резекцию простаты , были случайным образом распределены в две равные группы в качестве группы W- Группа стерильной воды и группа G-Glycine1,5%. Были отмечены и проанализированы наблюдения в отношении интраоперационной гемодинамики, гемоглобина, мочевины крови, креатинина сыворотки и электролитов сыворотки.

Результаты: Статистически изменения частоты сердечных сокращений, систолического и диастолического артериального давления во время процедуры в обеих группах были сходными. Сразу после операции и через 24 часа в обеих группах наблюдались сопоставимые изменения уровней гемоглобина, мочевины крови и креатинина сыворотки. Послеоперационная концентрация натрия в сыворотке была снижена, а концентрация калия в сыворотке значительно повышена в обеих группах. Эти изменения уровня натрия и калия в сыворотке были более заметными в группе W по сравнению с группой G; но разница в двух группах была статистически незначимой.Частота периоперационных осложнений была сопоставима в группах.

Заключение: По сравнению с глицином (1,5%), стерильная вода оказалась безопасной и недорогой ирригационной жидкостью для трансуретральной резекции предстательной железы (ТУРП). Что касается профиля безопасности, мы не обнаружили никакой разницы между двумя ирригационными жидкостями. Поскольку размер нашей выборки исследования был небольшим, необходимы дальнейшие аналогичные исследования на большом размере выборки, чтобы подтвердить наблюдения настоящего исследования.

Ключевые слова: Оросительные жидкости: Стерильная вода Vs. Глицин, трансуретральная резекция простаты (ТУРП), доброкачественная гиперплазия предстательной железы, ТУРП-синдром.

Ссылки

1.      Moorthy HK, Philip S. Синдром ТУРП – современные концепции патофизиологии и лечения. Индиан Дж. Урол, 2001 г .; 17:97-102.

2.      Porter M, McCormick B. Анестезия при трансуретральной резекции простаты. Обновление WFSA в анестезии 2003 г .; 25(16): 21-6

3.Хан Р.Г.: Абсорбция жидкости в эндоскопической хирургии. Бр J Анестезия. 2006, 96: 8-20.

4.      Хан Р.Г. Галлюцинации и нарушения зрения при трансуретральной резекции предстательной железы. Интенсивная терапия Мед. 1988, 14: 668-71.

5.      Байярд Р.В., Харрисон Р., Уэллс Р., Гилберт Д.Д. Токсичность глицина и неожиданная интраоперационная смерть. Судебно-медицинская экспертиза, 2001 г.; 46: 1244–1246.

6.      Коппингер С.В., Льюис К.А., Милрой Э.Дж. Способ измерения водного баланса при трансуретральной резекции предстательной железы.Бр Дж Урол. 1995 год; 76:66–72.

7.      Permi J: Кислая фосфатаза сыворотки при ТУР-синдроме. Анна. Чир. Гинекол. Доп. 1993 год; 206: 24-30.

8.      Хан Р.Г. Уровни кислой фосфатазы в сыворотке крови при трансуретральной простатэктомии. Бр Дж Урол. 1989 год; 64: 500–3.

9.      Hultén JO, Tran VT, Pettersson G. Контроль гемолиза при трансуретральной резекции простаты при использовании воды для ирригации: мониторинг абсорбции методом этанола. БЖУ Интерн. 2000 г.; 86: 989–92.

10. Хан Р.Г., Олссен Дж.: Мониторинг этанолом синдрома трансуретральной резекции. Джей Клин Анест. 1996, 8: 652-5.

11. Бендер Д.А., Коппингер С.В. Оценка ирригационной абсорбции при трансуретральной резекции простаты — оценка флуоресцеина как маркера. Урол Рез. 1992 год; 20:67–9.

12. Хан Р.Г. Курение увеличивает риск обширной абсорбции жидкости во время трансуретральной резекции предстательной железы. Дж Урол. 2001 г.; 166:162–5.

13. Агарвал Р., Эммет М.Посттрансуретральная резекция синдрома предстательной железы — терапевтические предложения. Am J почек Dis. 1994 год; 24:108–11.

14. Хан Р.Г.: Ирригационные жидкости в эндоскопической хирургии. Бр Дж Урол. 1997, 79: 669-80.

15. Мурти К., Филип С. Электролиты сыворотки при синдроме ТУРП. Недооценена ли роль калия? Индиан Дж. Анаст. 2002 г.; 46(6): 441-4.

16. Мохарари Р.С., Хаджави М.Р., Хадемхоссейни П., Хоссейни С.Р., Наджафи А. Стерильная вода в качестве ирригационной жидкости для трансуретральной резекции простаты: анестезиологический обзор записей 1600 случаев.Юг, апрель 2008 г.; 101(4):373-5.

17. Мемон А., Бухгольц Н.П., Салахуддин С. Вода в качестве ирриганта при трансуретральной резекции простаты: экономически эффективная альтернатива. Арх Итал Урол Андрол 1999; LXXI: 131–134.

18. Агамир С.М., Ализаде Ф., Мейсами А., Ассефи Рад С., Эдриси Л. Сравнение стерильной воды с изотоническим солевым раствором в качестве ирригационной жидкости при чрескожной нефролитотомии. Урол Дж. 2009; 6:249-53.

19. Dissayabutraa T. Орошение водой во время трансуретральной резекции простаты (ТУРП) вызывает внутрисосудистый гемолиз.Азиатская биомед. 2014 21 февраля; 7(6):795.

20. Ши Х.К., Кан Х.М., Ян Ч.Р., Хо В.М. Безопасность дистиллированной воды в качестве ирригационной жидкости при трансуретральной резекции предстательной железы. J Chin Med, 1999, август; 62(8):503-8.

21. Norlen H, Allegen LG: Сравнение прерывистой и непрерывной трансуретральной резекции предстательной железы. Сканд. Дж. Урол. Нефрол. 1993 год; 27(1): 21-5.

22. Московиц Б., Росс М., Болкиер М., Розенберг Б., Левин Д.Р.: Использование дистиллированной воды в качестве жидкости для орошения у пациентов, перенесших трансуретральную резекцию простаты.Евро. Урол. 1989 год; 16(4): 267-70.

Дорогой Марк: Глицин в качестве заменителя коллагена; Долг как болезнь цивилизации

В сегодняшнем выпуске «Дорогого Марка» я отвечаю на два вопроса. Во-первых, поскольку глицин часто называют основной причиной употребления студенистого мяса и добавок с гидролизатом коллагена, не могли бы мы просто дополнительно принимать глицин? Не упустим ли мы что-нибудь, если пойдем по этому пути? И во-вторых, я повторяю отличный комментарий из поста на прошлой неделе о финансовой безопасности.

Поехали:

Дэниел спросил:

Любые мысли о изолированном глицине по сравнению с коллагеном/желатином для пищевых добавок? Вы можете получить килограмм глицина на BulkSupplements.com примерно за 20 долларов, поэтому в пересчете на граммы глицина на доллар это намного дешевле, чем коллаген. Глицин тоже очень сладкий, почти такой же сладкий, как сахароза, так что может показаться, что это отличный полезный подсластитель.

Однако это хороший компромисс. Если бы я действительно нуждался в деньгах, я бы принял глицин в мгновение ока.

Чистый глицин отлично подходит для таких вещей, как балансировка потребления метионина. Если вы не в курсе, мышечное мясо богато аминокислотой под названием метионин. Метионин истощает запасы глицина, поэтому чем больше мяса вы едите, тем больше богатой глицином соединительной ткани, костного бульона и добавок коллагена вы должны есть, чтобы сбалансировать аминокислоты.

Но баланс метионина для долголетия и здоровья — не единственная причина, по которой мы едим коллаген. Коллаген является наиболее распространенным белком в организме, обеспечивающим прочность на растяжение наших костей, зубов, связок, сухожилий и хрящей.Это важный структурный компонент кожи, легких, кишечника и сердца. И, насколько свидетельствуют имеющиеся на сегодняшний день данные, употребление аминокислот, из которых состоит коллаген, по отдельности не оказывает такого же эффекта на эти коллагеновые ткани, как их совместное употребление в коллагеновой матрице.

Одна из причин заключается в том, что коллагеновая матрица может пережить пищеварение более или менее неповрежденной.

В одном исследовании крысы с остеопорозом ели гидролизат коллагена, который ученые пометили радиоактивной сигнатурой, чтобы позволить им отслеживать его движение в организме.Он выжил в желудочно-кишечном тракте, попал в кровь и накапливается в почках. К 14 дню бедренные кости крыс стали более прочными и плотными, с большим количеством органических веществ и меньшим содержанием воды.

Другое исследование дало аналогичные результаты, на этот раз для хряща колена. Мыши, которые ели радиоактивный гидролизат коллагена, показали повышенную радиоактивность в коленном суставе.

Дело в том, что коллаген больше, чем глицин. Когда вы кормите людей коллагеном, полученным из свиной кожи, куриных ножек и хрящей, в крови появляется множество различных коллагеновых пептидов.Вы не получите ничего из этого от изолированного глицина.

При всем при этом чистый глицин может быть полезной добавкой. Это отлично подходит для балансировки потребления метионина от потребления мышечного мяса. Он также использовался в нескольких исследованиях для улучшения нескольких маркеров качества сна. Это не второстепенные результаты. Они большие.

Коллаген — идеальный вариант, но глицин — неплохой вариант. На самом деле, я бы сказал, что, возможно, коллаген плюс дополнительный глицин могут предложить лучшую отдачу от затраченных средств.

Райан Парнем упоминается:

Отличная статья, полная правды! Финансовый долг определенно не относится к Праймалу, я имею в виду, я сомневаюсь, что Грок занимал деньги на какую-то редкую меховую набедренную повязку или что-то в этом роде!

Это отличный момент, Райан, который я не упомянул в посте. Финансовый долг — одна из величайших болезней цивилизации. До денег и кредита его просто не существовало.

Конечно, люди были в долгу друг перед другом. Вы выбываете на охоту в один сезон, и ваш приятель замечает вам и вашим родственникам немного мяса, вы чувствуете, что должны ему.Ощущение того, что вы что-то должны другому человеку за оказанные услуги, универсально, не требует формальной денежной системы и охватывает всю человеческую историю и предысторию. Речь идет о взаимном обмене личными отношениями и сообществом. Это способствует сотрудничеству и, вероятно, является частью того, что сделало нас такими успешными. Это фундаментальная человеческая психология.

Но это не то же самое, что нависший над головой долг. Быть в долгу перед кем-то основано на материальной реальности. Долг более абстрактен.Оно следует за вами. Это все время в твоей голове. Это почти как божество, сущность, существующая за пределами обычной временной реальности. Он не связан физикой или существованием холодного твердого материала. Назревает долг. Долг остается.

Это означает, что у нас не так много психологических или физиологических инструментов, чтобы справиться со стрессом долга здоровым образом. Точно так же, как лишение сна, чрезмерное количество масел из семян омега-6, слишком много рафинированных углеводов, отсутствие социальных контактов и малоподвижный образ жизни — все это эволюционно новые факторы, с которыми мы просто не можем справиться и которые приводят к множеству проблем со здоровьем, финансовых проблем. долг — это отклонение от человеческой психики. Нам лучше вообще его избегать, как я рекомендовал на прошлой неделе.

Надеюсь, сегодняшний рифф подчеркнул важность сообщения.

Итак, на сегодня все, ребята. Теперь давайте послушаем вас. Вы когда-нибудь пробовали глицин сам по себе? Как это по сравнению с коллагеном? И мне любопытно узнать, как вы относитесь к идее финансового долга как условия цивилизации.

Спасибо, что прочитали.

об авторе

Марк Сиссон — основатель Mark’s Daily Apple, крестный отец движения Primal food and lifestyle, а также New York Times автор бестселлера The Keto Reset Diet .Его последняя книга — Keto for Life , в которой он обсуждает, как он сочетает кето-диету с первобытным образом жизни для оптимального здоровья и долголетия. Марк также является автором множества других книг, в том числе The Primal Blueprint , которой приписывают ускорение роста движения первобытных/палео в 2009 году. После трех десятилетий исследований и обучения людей тому, почему еда является ключевым компонентом Для достижения и поддержания оптимального самочувствия Марк запустил Primal Kitchen, компанию по производству настоящих продуктов питания, которая создает основные продукты для кухни Primal/палео, кето и Whole30.

Почтовая навигация

Если вы хотите добавить аватар ко всем своим комментариям, нажмите здесь!

Разница между глицином и L-глицином

Опубликовано Madhu

Ключевое различие между глицином и L-глицином заключается в том, что -глицин представляет собой аминокислоту, из которой состоят белки, тогда как L-глицин является изомером глицина.

Глицин представляет собой аминокислоту. Он может встречаться в двух изомерных формах: D-глицин и L-глицин, которые являются структурными изомерами друг друга.Среди них L-глицин является стабильным и наиболее распространенным изомером в организмах, поскольку клетками используются только L-формы аминокислот.

СОДЕРЖАНИЕ

1. Обзор и ключевые отличия
2. Что такое глицин 
3. Что такое L-глицин
4. Прямые сравнения – глицин и L-глицин в табличной форме
5. Резюме

Что такое глицин?

Глицин — это аминокислота, которая помогает в построении белков. То есть; это строительный блок белков и подпадает под категорию протеиногенных аминокислот.Кроме того, он имеет один атом водорода в качестве боковой цепи. Следовательно, это самая простая аминокислота. Его химическая формула: NH 2 -CH 2 -COOH, а молярная масса 75,06 г/моль. Кроме того, он выглядит как белое твердое вещество при стандартной температуре и давлении. Температура плавления составляет 233 °C, и выше этой температуры соединения подвергаются разложению. Мы можем обозначить глицин как «Gly».

Рисунок 01: Внешний вид глицина

Основными источниками глицина являются мясо, рыба, молочные продукты, бобовые и т. д.Это продукты, богатые белком. Кроме того, мы можем использовать глицин в качестве лекарства для лечения шизофрении, инсульта, проблем со сном, доброкачественной гиперплазии предстательной железы (ДГПЖ), метаболического синдрома и т. д. Среди других применений:

  • В качестве компонента пищевых продуктов – в качестве добавки в корма для домашних животных и корма для животных
  • Косметические применения – служит буферным агентом в косметике
  • Химическое сырье – используется для синтеза различных органических соединений

Что такое L-глицин?

L глицин является изомером аминокислоты глицина.Существует два структурных изомера глицина: D-изомер и L-изомер. L-изомер или L-глицин является наиболее распространенной формой, потому что наши клетки используют только этот изомер. Таким образом, L-глицин распространен в биологических системах по сравнению с D-глицином. Более того, свойства и применение, которые мы обсуждали выше, относятся и к L-глицину, поскольку для нас важен именно изомер.

В чем разница между глицином и L-глицином?

Глицин является протеиногенной аминокислотой и имеет два структурных изомера: D-глицин и L-глицин.Итак, ключевое различие между глицином и L-глицином заключается в том, что глицин — это аминокислота, из которой состоят белки, тогда как L-глицин — это изомер глицина.

Резюме

— Глицин против L-глицина

Основное различие между глицином и L-глицином заключается в том, что глицин представляет собой аминокислоту, из которой состоят белки, тогда как L-глицин является изомером глицина. Когда мы говорим о глицине, мы на самом деле говорим о L-глицине, потому что это наиболее стабильная и распространенная форма в биологических системах.Это потому, что наши клетки используют только L-изомер. Кроме того, это соединение имеет множество применений, включая медицинские применения.

Артикул:

1. «Глицин: применение, побочные эффекты, взаимодействие, дозировка и предупреждения». WebMD, доступно здесь.

Изображение предоставлено:

1. «Глицин» от SPOTzillah — собственная работа (CC BY-SA 4.0) через Commons Wikimedia

%PDF-1.4 % 670 0 объект > эндообъект внешняя ссылка 670 95 0000000016 00000 н 0000002902 00000 н 0000003081 00000 н 0000003116 00000 н 0000003765 ​​00000 н 0000003792 00000 н 0000003935 00000 н 0000004074 00000 н 0000004269 00000 н 0000004550 00000 н 0000004970 00000 н 0000005018 00000 н 0000005132 00000 н 0000005424 00000 н 0000005747 00000 н 0000006004 00000 н 0000006360 00000 н 0000007725 00000 н 0000007857 00000 н 0000008258 00000 н 0000008605 00000 н 0000009128 00000 н 0000009891 00000 н 0000009918 00000 н 0000010473 00000 н 0000011799 00000 н 0000013165 00000 н 0000014302 00000 н 0000014567 00000 н 0000015782 00000 н 0000015914 00000 н 0000016095 00000 н 0000017279 00000 н 0000017416 00000 н 0000017745 00000 н 0000017772 00000 н 0000018284 00000 н 0000019586 00000 н 0000019893 00000 н 0000021025 00000 н 0000021296 00000 н 0000021760 00000 н 0000021830 00000 н 0000022618 00000 н 0000023459 00000 н 0000061804 00000 н 0000061960 00000 н 0000062030 00000 н 0000088178 00000 н 0000088309 00000 н 0000113344 00000 н 0000113609 00000 н 0000113665 00000 н 0000113735 00000 н 0000113868 00000 н 0000138653 00000 н 0000138933 00000 н 0000139438 00000 н 0000139465 00000 н 0000140004 00000 н 0000140074 00000 н 0000140213 00000 н 0000168496 00000 н 0000168771 00000 н 0000169331 00000 н 0000169358 00000 н 0000169941 00000 н 0000170011 00000 н 0000170096 00000 н 0000179088 00000 н 0000179351 00000 н 0000183897 00000 н 0000183924 00000 н 0000184225 00000 н 0000186437 00000 н 0000186827 00000 н 0000187243 00000 н 0000213979 00000 н 0000214239 00000 н 0000214677 00000 н 0000220142 00000 н 0000220417 00000 н 0000220826 00000 н 0000242654 00000 н 0000242919 00000 н 0000243233 00000 н 0000262114 00000 н 0000262369 00000 н 0000262675 00000 н 0000269168 00000 н 0000269423 00000 н 0000269818 00000 н 0000270664 00000 н 0000002707 00000 н 0000002240 00000 н трейлер ]/Предыдущая 354309/XRefStm 2707>> startxref 0 %%EOF 764 0 объект >поток hb«b`2c`g` À

Ингибирование пути синтеза серина в сочетании с диетическим ограничением серина и глицина для терапии рака

Клеточная культура

Все линии клеток человека, использованные в этом исследовании, были получены от Crick Cell Services.Все клеточные линии прошли стандартный контроль качества, который включал обнаружение микоплазмы, профилирование STR и идентификацию видов для проверки. Клетки культивировали при 37 °C во влажной атмосфере 5% CO 2 . Клетки HT-29, SW48, SW480, SW620, CACO2, HCT116, RKO, VACO5 и MDA-MB-468 культивировали в среде DMEM (Gibco, 41966) с добавлением 10% FBS; Клетки DLD-1, HCT-15 и SW1417 культивировали в среде RPMI 1640 (Gibco, 21875) с добавлением 10% FBS, а клетки LoVo и CL-34 культивировали в среде DMEM/F12 (Gibco, 11320) с добавлением 10% FBS.

Депривация серина и глицина

Для всех экспериментов с депривацией серина и глицина клетки культивировали в MEM (Gibco, 21090) с добавлением 10% диализированного FBS (Hyclone, Thermo Scientific), 1% пенициллина-стрептомицина, d-глюкозы ( 5 мМ), пируват натрия (65 мкМ), 1X раствор витамина МЕМ (Gibco, 11120), л-глутамин (2 мМ), л-пролин (0,15 мМ), л-аланин (0,15 мМ), л-аспарагиновая кислота ( 0,15 мМ), l-глутаминовая кислота (0,15 мМ) и l-аспарагин (0,34 мМ) (среда -SG). Полная среда (CM) соответствует ранее описанной среде с добавлением 0.4 мМ л-серина и 0,4 мМ л-глицина.

Кривые роста

Клетки (от 2 × 10 4 до 3 × 10 4 клеток/лунку в зависимости от клеточных линий) высевали в 24-луночные планшеты в их обычной среде. На следующий день после промывания PBS клетки переносили в среду -SG или CM и обрабатывали 10 мкМ PH755 (RAZE Therapeutics), разведенным в ДМСО или только ДМСО. Для стадии подсчета клетки обрабатывали трипсином, суспендировали в PBS-EDTA и подсчитывали с помощью счетчика клеток CASY Model TT (Innovatis, Roche Applied Science).Относительное количество клеток в каждый момент времени рассчитывали на основе количества клеток, измеренного до смены среды. Для эксперимента с кривой роста с добавлением формиата и глицина клетки HT-29, HCT116 и DLD-1 высевали в 24-луночные планшеты (2 × 10 4 клеток/лунку). Формиат натрия (Fluka Analytical, 71540) (1 мМ) и/или глицин (0,4 мМ) разводили в среде -SG + 10 мкМ PH755, и среду обновляли каждые два дня.

Органоиды

Crypts были выделены из аденоматозной тонкой кишки, полученные из VIL1-Creer; APC FL и Vil1-Creer; APC FL / FL ; KRAS G12D/+ мыши, как описано ранее 17 .Создание органоида Apc5 , несущего укороченную мутацию Apc , с использованием технологии CRISPR/Cas9 и выделение нормальных органоидов, полученных из проксимальной части здоровой тонкой кишки мыши Villin -CreERT2, проводили, как описано ранее 50,51 ,52 . Генерация четырех колоректальных органоидов, полученных от пациентов, используемых в этом исследовании, была описана ранее 32 . Раковые органоиды мышей культивировали в среде для опухолевых органоидов (CM), состоящей из Advanced DMEM/F12 (Gibco, 12634) с добавлением 1% раствора пенициллина-стрептомицина, 0.1% BSA, 2 мМ l-глутамина, 10 мМ Hepes, 50 нг/мл EGF (PeproTech AF-100-15), 100 нг/мл Noggin (PeproTech 250-38), 500 нг/мл спондина (PeproTech 120-38). ), 1 добавка N-2 (ThermoFisher 17502048) и 1 добавка B-27 (ThermoFisher 17504044). Среда -SG соответствует ранее описанной среде без серина и глицина. Нормальные органоиды мышей выращивали в среде нормальных органоидов, модификации среды опухолевых органоидов с добавлением 100 нг/мл Wnt-3a (R&D systems, 5036-WN), 1 мМ N -ацетил-l-цистеина (Sigma , A7250), 10 мкМ Y-27632 (Sigma, Y0503) и 4  мМ никотинамида (Sigma, N0636).Органоиды человека выращивали в органоидной среде человека, второй модификации среды опухолевых органоидов, в которую добавляли 10 нМ FGF-basic (PeproTech, 100-18B), 100 нг/мл Wnt-3a (R&D systems, 5036-WN), 1 мкМ простагландина E2 (Tocris, 2296), 4 мМ никотинамида (Sigma, N0636), 20 нг/мл HGF (PeproTech, 100-39), 10 нМ FGF-10 (PeproTech, 100-26), 10 нМ гастрина I (Sigma , G9145), 10 мкМ Y-27632 (Sigma, Y0503), 0,5 мкМ A 83-01 (Tocris, 2939) и 5 ​​мкМ SB 202190 (Sigma, S7067). На этапе расщепления органоиды собирали с помощью механического пипетирования с использованием TrypLE (Gibco, A12177-01), инкубировали в течение 10 минут при 37 °C, разбавляли в три раза по объему охлажденным льдом 1X HBSS (Gibco, 14175-053) и центрифугировали. вниз при 270× г в течение 5 мин при 4 °C.Затем осадок ресуспендировали в Matrigel с пониженным содержанием фактора роста (Corning, 356231) и высевали в 24-луночные планшеты. Затем матригель инкубировали в течение 15 мин при 37°С и добавляли 1 мл СМ, описанного выше. На следующий день органоиды промывали PBS, а среду заменяли средой CM или -SG с добавлением или без добавления 10 мкМ PH755 и позволяли расти. Снимки регулярно делались с помощью светового микроскопа (Zeiss, Axiovert 40 CFL) с использованием Infinity Capture (версия 6.5.4), а диаметр органоида измерялся с помощью программного обеспечения ImageJ.

Создание клеток PHGDH KO

Вектор pLentiCRISPRv2, содержащий следующую направляющую РНК: TGGACGAAGGCGCCCTGCTC, был приобретен у Genscript для целевого PHGDH . Клетки HEK293T трансфицировали этой лентивирусной плазмидой вместе с psPAX2 (Addgene, 12260) и VSV.G (Addgene, 14888) с использованием реактива jetPRIME (трансфекция Polyplus). Через 24 ч инкубации среду меняли, а через 48 ч среду, содержащую вирусные частицы, фильтровали (0,45 мм) и смешивали с полибреном (4 мкг/мл, Sigma-Aldrich).Среду, содержащую лентивирусы, инкубировали с клетками-мишенями в течение 24 часов. Затем клетки HT-29 и DLD-1 отбирали с помощью пуромицина (Sigma-Aldrich) в течение 3 недель и анализировали на потерю экспрессии PHGDH.

Трансфекция siRNA ATF-4

siRNA, используемая для подавления человеческого ATF-4, и нецелевой контроль siRNA были приобретены у Dharmacon (siRNA siGENOME SMART pool). Клетки трансфицировали миРНК с использованием реагента для трансфекции Lullaby (OZ Biosciences) в соответствии с инструкциями производителя.

Окрашивание BrdU/7-AAD

Клетки HCT116 и DLD-1 выращивали в течение 48 ч в среде -SG или CM и обрабатывали 10 мкМ PH755, разведенным в ДМСО или только ДМСО. Чтобы определить процент клеток, положительных на бромдезоксиуридин (BrdU), 10 мкМ BrdU затем добавляли к культуральной среде еще на 5 часов, а для анализа клеточного цикла 10 мкМ BrdU добавляли только на 30 минут. Затем клетки собирали, фиксировали и окрашивали антителом APC против BrdU (и 7-AAD для анализа клеточного цикла) с использованием набора APC BrdU Flow (BD Pharmingen, номер по каталогу: 552598) в соответствии с инструкциями производителя.Флуоресценцию получали с помощью FACSdiva на проточном цитометре Fortessa, а анализ выполняли с помощью FlowJo (версия 10.5.2).

Вестерн-блоттинг

Белковые лизаты обрабатывали в RIPA-буфере (Millipore) с добавлением смеси ингибиторов фосфатазы (Thermo Fisher Scientific) и полных ингибиторов протеаз (Roche). Лизаты разделяли с использованием готовых гелей NuPAGE 4–12% Bis-Tris Protein (Invitrogen) и переносили на нитроцеллюлозные мембраны. После инкубации с первичными антителами для обнаружения белков использовали соответствующие вторичные антитела.Вестерн-блоты сканировали с помощью инфракрасного сканера LI-COR Odyssey (изображение с использованием программного обеспечения LI-COR Image Studio Lite версии 5.2.5) или визуализировали с помощью наборов для обнаружения хемилюминесценции ECL (Pierce). Были использованы следующие первичные антитела: PHGDH (13428), ATF-4 (11815), Phospho-eIF2α (Ser51) (3398), киназа Phospho-p70S6 (Thr389) (9234), киназа p70S6 (9202), c-Myc ( 5605), HIF1α (14179), каспаза-3 (9662), расщепленная каспаза-3 (Asp175) (9661), бета-актин (4970) от Cell Signaling Technology; GCN2 (sc-374609), eIF2α (sc-133132), p53 (sc-126), винкулин (sc-73614) от Santa Cruz Biotechnology; PSAT (ab96136), PSPH (ab96414), Phospho-GCN2 (Thr899) (ab75836) от Abcam; ASNS (HPA029318) от Atlas Antibodies; Пуромицин (MABE343) от Sigma-Aldrich.Все первичные антитела разводили в разведении 1:1000, кроме антитела к пуромицину (1:20000). Необрезанные и необработанные сканы наиболее важных блотов представлены в файле исходных данных.

Синтез и расщепление белка

Клетки выращивали в течение 24 ч в среде -SG или CM и обрабатывали 10 мкМ PH755, разведенным в ДМСО или только ДМСО. Для оценки синтеза белка в каждую лунку добавляли пуромицин (конечная концентрация: 90 мкМ) за 10 мин до сбора клеток для вестерн-блоттинга, за исключением лунки с отрицательным контролем.Там, где указано, клетки, выращенные в среде CM, обрабатывали циклогексимидом (10 мкг/мл) в течение последних 5 часов, обеспечивая контроль ингибирования трансляции. Включение пуромицина во вновь синтезированные белки оценивали вестерн-блоттингом с использованием антитела против пуромицина (Sigma-Aldrich, MABE343). Для оценки накопления короткоживущих белков в ответ на ингибирование протеасом клетки, выращенные в среде -SG или CM плюс или минус 10 мкМ PH755 в течение 24 ч, обрабатывали в течение последних 6 ч ингибитором протеасом MG-132 (10 мкМ). перед сбором клеток для вестерн-блоттинга.

qPCR

Клетки HT-29, HCT116 и DLD-1 выращивали в течение 6 ч или 24 ч в среде -SG или CM и обрабатывали 10 мкМ PH755, разведенным в ДМСО или только ДМСО. Суммарную РНК экстрагировали с использованием набора RNeasy Mini (Qiagen, № по каталогу: 74104), выполняя расщепление ДНК на колонке (Qiagen, набор ДНКаз без РНКазы, № по каталогу: 79254) и подвергали обратной транскрипции с использованием высокопроизводительного набора для обратной транскрипции кДНК. комплект (Thermofisher, номер по каталогу: 4368814) в соответствии с инструкциями производителя. КПЦР проводили с использованием мастер-микса PrimeTime Gene Expression Master Mix (IDT, каталожный номер: 1055771) с праймерами, перечисленными в дополнительной таблице 1.Для всех реакций использовали систему ПЦР в реальном времени QuantStudio 7 Flex (программное обеспечение версии 1.3). Экспрессию гена нормализовали по ACTB (β-актин) гену домашнего хозяйства, анализировали в соответствии с методом Pfaffl 53 и выражали в относительных единицах по сравнению с клетками, выращенными в CM в течение 6 часов.

Жидкостная хроматография-масс-спектрометрия

Клетки НТ-29 (2,4 × 10 5 ), клетки HCT116 (1,8 × 10 5 ), клетки DLD-1 (1,8 × 10 5 ), клетки DLD-1 (1,8 4× 3 5MB-03 9004 468 ячеек (2.4 × 10 5 ) высевали в шестилуночные планшеты в обычной среде. Дублирующие планшеты использовали для подсчета клеток, чтобы нормализовать анализ ЖХ-МС на основе количества клеток. Через 16 часов клетки промывали PBS и переносили в среду CM или -SG с добавлением или без добавления 10 мкМ PH755 на 24 часа. Всего за 6 часов до экстракции метаболитов среду заменяли средой CM или -SG ±10 мкМ PH755 с глюкозой, замененной на 10 мМ U-[ 13 C]-глюкозы (Cambridge Isotopes). Для краткосрочных экспериментов клетки переносили в ранее описанную среду с глюкозой, замененной 10 мМ U-[ 13 C]-глюкозы, всего на 3 или 6 часов перед экстракцией метаболитов.Для измерения превращения глицина в серин во время эксперимента по спасению клетки выращивали в течение 24 ч в среде -SG с добавлением 10 мкМ PH755, 1 мМ формиата натрия и 0,4 мМ глицина. Затем эту среду заменяли соответствующей средой с заменой глицина на 0,4 мМ 13 C 2 15 N 1 -глицина в течение 1 ч перед экстракцией метаболита. Для половины образцов в среду добавляли 1 мМ немеченого серина в импульсном режиме за 1 мин до экстракции метаболита, чтобы обеспечить накопление меченого серина.Затем клетки промывали PBS и метаболиты экстрагировали с использованием ледяного экстракционного буфера, состоящего из метанола, ацетонитрила и H 2 O в следующем соотношении 50:30:20. Для анализа образцов опухолей методом ЖХ-МС ткань гомогенизировали (20–40 мг ткани/мл ранее описанного буфера для экстракции) с использованием гомогенизатора Precellys 24 (Bertin Instruments). Образцы центрифугировали (16 000× г /10 мин/0 °C) и супернатант собирали для повторного центрифугирования (16000× г /10 мин/0 °C).Затем собирали супернатант для анализа ЖХ-МС. Для ЖХ-МС анализа плазмы мышей плазму разбавляли в 20–50 раз тем же буфером для экстракции, встряхивали в течение 30 с и центрифугировали (16 000× г /10 мин/0 °C). Затем собирали супернатант для анализа. Абсолютные уровни серина и глицина в плазме определяли с помощью 8-точечных калибровочных кривых (от 2,5 до 800 мкМ) с 13 C 3 15 N 1 -серин и 13

4 2 1100050 0 N 1 -глицин, разведенный в плазме.Анализ ЖХ-МС проводили, как описано ранее 9 . Данные регистрировали с помощью программного обеспечения Xcalibur 4.0.27.19 (Thermo Scientific). Проверка качественных отнесений пиков проводилась с помощью Qual Browser из Xcalibur 4.0.27.19, а интеграция пиков метаболитов выполнялась с использованием TraceFinder 4.1.

Эксперименты in vivo

Все исследования на животных проводились в соответствии с лицензиями на проекты, одобренными Министерством внутренних дел Великобритании (Закон о животных (научные процедуры) 1986 г. и Директива ЕС 2010 г.).Эксперименты на животных подлежат этической экспертизе со стороны Фрэнсиса Крика, органа по защите животных и этической экспертизы, и проводятся в соответствии с проектной лицензией Министерства внутренних дел Великобритании P319AE968 или Институтом Битсона CRUK (рассмотрено и одобрено Университетом Глазго и Министерством внутренних дел Великобритании). в соответствии с лицензией на проект Министерства внутренних дел Великобритании 70/8645. Мышам (3–5 в клетке) давали свободный доступ к пище и воде и содержали в 12-часовом цикле день/ночь, начиная с 7:00 до 19:00. Комнаты содержались при температуре 21 °C и влажности 55%.Мышам давали возможность акклиматизироваться в течение по крайней мере 1 недели до эксперимента. Затем они были случайным образом распределены по экспериментальным группам. Экспериментальные диеты, использованные в этом исследовании (контрольная диета и диета с SG), ранее были описаны как «Рацион 1-Контроль» и «Рацион 1 без SG» 17 . Вкратце, контрольная диета содержит все незаменимые аминокислоты, а также серин, глицин, глютамин, аргинин, цистин и тирозин. Рацион -SG аналогичен контрольному рациону, но лишен серина и глицина, которые компенсируются пропорционально повышенным уровнем других аминокислот для достижения такого же общего содержания аминокислот.

Эксперименты с ксенотрансплантатом

Самки голых мышей CD-1 (полученные из Charles River, возраст 7–9 недель) получали односторонние подкожные инъекции 100 мкл клеток HCT116 (2 × 10 6 клеток) или 100 мкл DLD-1 клетки (4 × 10 6 клеток), суспендированные в PBS. Мышей помещали на экспериментальную диету (контроль или -SG) через 10 дней (для эксперимента с ксенотрансплантатом HCT116) или через 2 дня (для эксперимента с ксенотрансплантатом DLD-1) после инъекций опухоли. Всего через 4 дня (для эксперимента с ксенотрансплантатом HCT116) или через 2 дня (для эксперимента с ксенотрансплантатом DLD-1) после изменения диеты мышам вводили либо носитель (0.5% метилцеллюлоза (Sigma, H7509), 0,5% Tween-80 (Sigma, P8192)) или PH755 (полученный от Raze Therapeutics), приготовленные в носителе один раз в день через пероральный зонд. Начальная доза PH755 составляла 100 мг/кг и впоследствии была снижена до 75 мг/кг или 50 мг/кг, как указано в подписях к рисункам. Подкожный рост измеряли штангенциркулем два-три раза в неделю, и для расчета объема опухоли использовали следующую формулу: длина × ширина 2 /2.

Эксперимент C57BL/6J

Самцов мышей C57BL/6J (полученных из Charles River, возраст 14 недель) помещали на экспериментальную диету (контрольную или -SG) за 2 дня до начала лечения PH755 или его носителем.Мышей лечили один раз в день через желудочный зонд PH755 или его носителем в течение 20 дней. Начальная доза PH755 составляла 75 мг/кг и впоследствии была снижена до 50 мг/кг, чтобы поддерживать потерю веса ниже 20% от исходной массы тела.

Иммуногистохимия

Все ткани фиксировали в 10% нейтральном забуференном формалине и заливали в парафин. Для окрашивания PHGDH и PSAT1 предметные стекла депарафинизировали в ксилоле и регидратировали с использованием ряда растворов промышленного денатурата и дистиллированной воды.Извлечение антигена проводили в течение 23 мин в микроволновой печи с использованием 0,1 М цитратного буфера с рН 6. Блокирование эндогенной пероксидазы осуществляли с использованием 1,6% H 2 O 2 в течение 10 минут при комнатной температуре, а блокирование белков осуществляли с использованием 2,5% нормальной лошадиной сыворотки (MP-7401, Vector) в течение ночи при 4°C. Первичное антитело разводили в соотношении 1:1000 для антитела PHGDH (HPA021241, Sigma-Aldrich) и в отношении 1:500 для антитела PSAT1 (PA5-22124, Thermofisher) в 1% BSA и инкубировали в течение 1 часа при комнатной температуре.Полимер HRP Horse Anti-Rabbit IgG (MP-7401, Vector) инкубировали в течение 30 минут при комнатной температуре. Хромоген 3,3-диаминобензидина (DAB) (SK-4100, Vector) инкубировали в течение 10 мин при комнатной температуре. Предметные стекла были контрастно окрашены гематоксилином Harris, обезвожены, очищены и помещены в автоматический краситель Sakura Tissue-Tek Prisma®. Для количественной оценки интенсивности окрашивания PHGDH и PSAT1 количественно определяли минимум три поля на опухоль, как описано в Crowe et al. 54 с ImageJ. Иммуногистохимию активной каспазы-3 проводили на платформе Discovery Ultra Ventana (от Roche).Извлечение антигена проводили с помощью Cell Conditioning 1 (CC1) от Ventana Medical Systems. Первичное антитело (AF835, R&D Systems) разводили в соотношении 1:1250 и инкубировали в течение 60 мин. Для окрашивания активной каспазы-3 количественно определяли минимум три поля на опухоль с помощью алгоритма обнаружения положительных клеток от QuPath (версия 0.1.2). Все слайды были отсканированы с помощью сканера слайдов ZEISS Axio Scan.Z1, а изображения были созданы с помощью программного обеспечения ZEISS ZEN 2.6 (blue edition). Для рулонов кишки иммуногистохимию выполняли на Bond Rx Autostainer от Leica Biosystems с использованием набора для окрашивания Leica Bond Intense R.Предметные стекла депарафинизировали с помощью Bond Dewax при 72°С в течение 30 мин, а выделение антигена осуществляли с помощью ER2 при 100°С в течение 20 мин. Первичное антитело (Ki67 SP6, ab16667, Abcam) разводили в соотношении 1/100 и инкубировали в течение 35 мин. Для измерения длины ворсинок с помощью ImageJ измеряли ворсинки из той же области тонкой кишки (не менее 15 на мышь) от соединения крипта/ворсинка до кончика ворсинки.

Взятие проб головного мозга и патологоанатомическое исследование

Мышей C57BL/6J забивали с помощью удушения углекислым газом, чтобы избежать физической травмы головного мозга.Мышей немедленно препарировали и с поверхности черепа удаляли волосатую кожу и мягкие ткани. Были выполнены разрезы по всему теменному и лобному швам, чтобы обеспечить быстрое проникновение фиксирующего раствора в паренхиму головного мозга. Голову погружали в 250 мл 10% нейтрального забуференного формалина и фиксировали на 2 недели. После полной фиксации мозг удаляли из черепа и обрезали, используя матрицу мозга мыши (BSMYS001-1; Zivic Instruments, Питтсбург, Пенсильвания). Были получены четыре коронарных среза на уровне грушевидной коры, каудального промежуточного мозга, каудального среднего мозга и рострального мозжечка.Образцы тканей обычно обрабатывали для заливки парафином, делали срезы толщиной 4 мкм и окрашивали гематоксилином и эозином. Гистопатологические критерии, описанные в диагностической схеме INHAND, использовались для выявления возможных микроскопических изменений 55 . Гистопатологическое исследование головного мозга проводилось сертифицированным ветеринарным патологоанатомом.

Анализы биохимических маркеров крови

Активность АЛТ и АСТ в плазме измеряли с помощью набора для анализа активности аланинтрансаминазы (Abcam, № по каталогу: ab105134) и набор для анализа активности AST (Sigma-Aldrich, номер по каталогу: MAK055-1KT) соответственно в соответствии с инструкциями производителя.

Статистический анализ

Все данные выражены как среднее ± SEM, и каждый статистический анализ подробно описан в подписи к рисунку. Данные были собраны в Excel (версия 16.16.26), и весь статистический анализ был выполнен с использованием программного обеспечения GraphPad Prism 8 (версия 8.3.1). Для сравнения двух групп друг с другом был проведен непарный тест Стьюдента t .Если дисперсия между двумя группами была неравной, применялась поправка Уэлча. Для сравнения более чем двух групп статистическую значимость определяли с помощью однофакторного ANOVA с тестом множественных сравнений Тьюки. Для анализа объема опухоли и массы тела был проведен двухсторонний ANOVA плюс апостериорный критерий Тьюки. p Значение ниже 0,05 считалось статистически значимым. Значимость указана следующим образом: * p  < 0,05, ** p  < 0,01, *** p  < 0.001, **** p  < 0,0001, нс: не имеет значения. Все измерения были взяты из отдельных образцов. Размеры выборки были основаны на стандартных протоколах в полевых условиях, а метаболические образцы были распределены в случайном порядке перед анализом.

Добавить комментарий

Ваш адрес email не будет опубликован.